EMAIL THIS PAGE TO A FRIEND

PIK3C2B

phosphatidylinositol-4-phosphate 3-kinase, catalytic subunit type 2 beta

127 Gene Product Result for
Synonyms: C2-PI3K
UniProtKB ID: O00750, O95666, Q5SW99
Gene ID:
Human(5287) Summary: The protein encoded by this gene belongs to the phosphoinositide 3-kinase (PI3K) family. PI3-kinases play roles in signaling pathways involved in cell proliferation, oncogenic transformation, cell survival, cell migration, and intracellular protein trafficking. This protein contains a lipid kinase catalytic domain as well as a C-terminal C2 domain, a characteristic of class II PI3-kinases. C2 domains act as calcium-dependent phospholipid binding motifs that mediate translocation of proteins to membranes, and may also mediate protein-protein interactions. The PI3-kinase activity of this protein is sensitive to low nanomolar levels of the inhibitor wortmanin. The C2 domain of this protein was shown to bind phospholipids but not Ca2+, which suggests that this enzyme may function in a calcium-independent manner. [provided by RefSeq, Jul 2008]
Mouse(240752) phosphoinositide-3-kinase, class 2, beta polypeptide
Rat(289021) phosphatidylinositol-4-phosphate 3-kinase, catalytic subunit type 2 beta
Zebrafish(567938) phosphoinositide-3-kinase, class 2, beta polypeptide
Horse(100054391) phosphatidylinositol-4-phosphate 3-kinase, catalytic subunit type 2 beta
domestic cat(101082204) phosphatidylinositol-4-phosphate 3-kinase, catalytic subunit type 2 beta
dog(478938) phosphatidylinositol-4-phosphate 3-kinase, catalytic subunit type 2 beta
chicken(419822) phosphoinositide-3-kinase, class 2, beta polypeptide
cow(537396) phosphatidylinositol-4-phosphate 3-kinase, catalytic subunit type 2 beta
sheep(101108766) phosphatidylinositol-4-phosphate 3-kinase, catalytic subunit type 2 beta
Domestic Rabbit(100351938) phosphatidylinositol-4-phosphate 3-kinase, catalytic subunit type 2 beta
naked mole-rat(101721434) phosphatidylinositol-4-phosphate 3-kinase, catalytic subunit type 2 beta
domestic guinea pig(100719801) phosphatidylinositol-4-phosphate 3-kinase, catalytic subunit type 2 beta
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001099276 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001099276 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001099276 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002646 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002646 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002646 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_136225 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_136225 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_136225 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU024231 MISSION® esiRNA targeting human PIK3C2B human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002646 Rosetta Predictions human pricing
NM_001105951 Rosetta Predictions rat pricing
XM_001001586 Rosetta Predictions mouse pricing
XM_001001599 Rosetta Predictions mouse pricing
XM_001479658 Rosetta Predictions mouse pricing
XM_914845 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002646 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00163846 predicted 1203
2 SASI_Hs01_00163847 predicted 4829
3 SASI_Hs01_00163848 predicted 1037
4 SASI_Hs02_00334178 predicted 3385
5 SASI_Hs01_00163849 predicted 4407
6 SASI_Hs01_00163850 predicted 1148
7 SASI_Hs01_00163851 predicted 1672
8 SASI_Hs01_00163852 predicted 1811
9 SASI_Hs01_00163853 predicted 738
10 SASI_Hs01_00163854 predicted 4559
11 SASI_Hs01_00163855 predicted 917
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105951 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00214152 predicted 4370
2 SASI_Rn02_00214153 predicted 1170
3 SASI_Rn02_00214154 predicted 1027
4 SASI_Rn02_00214155 predicted 4570
5 SASI_Rn02_00214156 predicted 4449
6 SASI_Rn02_00214157 predicted 2910
7 SASI_Rn02_00214158 predicted 1516
8 SASI_Rn02_00214159 predicted 1530
9 SASI_Rn02_00214160 predicted 739
10 SASI_Rn02_00214161 predicted 4771
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001001586 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00268504 predicted 1364
2 SASI_Mm01_00268505 predicted 1196
3 SASI_Mm01_00268506 predicted 998
4 SASI_Mm01_00268507 predicted 604
5 SASI_Mm01_00268508 predicted 1394
6 SASI_Mm01_00268509 predicted 1449
7 SASI_Mm01_00268510 predicted 1077
8 SASI_Mm01_00268511 predicted 1483
9 SASI_Mm01_00268512 predicted 732
10 SASI_Mm01_00268513 predicted 770
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001001599 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00214432 predicted 1367
2 SASI_Mm01_00214433 predicted 1200
3 SASI_Mm01_00214434 predicted 1839
4 SASI_Mm01_00214435 predicted 2215
5 SASI_Mm01_00214436 predicted 1851
6 SASI_Mm01_00214437 predicted 2148
7 SASI_Mm01_00214438 predicted 1570
8 SASI_Mm01_00214439 predicted 1541
9 SASI_Mm01_00214440 predicted 2530
10 SASI_Mm01_00214441 predicted 1399
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001479658 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00411665 predicted 865
2 SASI_Mm02_00411666 predicted 694
3 SASI_Mm02_00411667 predicted 1336
4 SASI_Mm02_00411668 predicted 1718
5 SASI_Mm02_00411669 predicted 1339
6 SASI_Mm02_00411670 predicted 1641
7 SASI_Mm02_00411671 predicted 1065
8 SASI_Mm02_00411672 predicted 2020
9 SASI_Mm02_00411673 predicted 898
10 SASI_Mm02_00411674 predicted 956
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_914845 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00438943 predicted 862
2 SASI_Mm02_00438944 predicted 695
3 SASI_Mm02_00438945 predicted 1347
4 SASI_Mm02_00438946 predicted 1638
5 SASI_Mm02_00438947 predicted 2023
6 SASI_Mm02_00438948 predicted 900
7 SASI_Mm02_00438949 predicted 963
8 SASI_Mm02_00438950 predicted 2469
9 SASI_Mm02_00438951 predicted 3616
10 SASI_Mm02_00438952 predicted 264
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001099276
PIK3C2B MISSION shRNA Bacterial Glycerol Stock
phosphatidylinositol-4-phosphate 3-kinase, catalytic subunit type 2 beta
Mouse
3 Products Total
TRC Number Price Set Price (3)? Select
TRCN0000360942    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099276.2-2651s21c1
Sequence:CCGGGGGTTCCTCTGAAGCGAATAACTCGAGTTATTCGCTTCAGAGGAACCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360890    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099276.2-4088s21c1
Sequence:CCGGCAATGACAACATCATGCTAAACTCGAGTTTAGCATGATGTTGTCATTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360889    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099276.2-5054s21c1
Sequence:CCGGCTTCATCATGGTGATGCATATCTCGAGATATGCATCACCATGATGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001099276
PIK3C2B MISSION shRNA shRNA Plasmid DNA
phosphatidylinositol-4-phosphate 3-kinase, catalytic subunit type 2 beta
Mouse
3 Products Total
TRC Number Vector Price Set Price (3)? Select
TRCN0000360942    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099276.2-2651s21c1
Sequence:CCGGGGGTTCCTCTGAAGCGAATAACTCGAGTTATTCGCTTCAGAGGAACCCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000360890    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099276.2-4088s21c1
Sequence:CCGGCAATGACAACATCATGCTAAACTCGAGTTTAGCATGATGTTGTCATTGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000360889    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099276.2-5054s21c1
Sequence:CCGGCTTCATCATGGTGATGCATATCTCGAGATATGCATCACCATGATGAAGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001099276
PIK3C2B MISSION shRNA Lentiviral Transduction Particles
phosphatidylinositol-4-phosphate 3-kinase, catalytic subunit type 2 beta
Mouse
3 Products Total
TRC Number Volume Titer/mL Vector Price Set Price (3)? Select
TRCN0000360942    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099276.2-2651s21c1
Sequence:CCGGGGGTTCCTCTGAAGCGAATAACTCGAGTTATTCGCTTCAGAGGAACCCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000360890    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099276.2-4088s21c1
Sequence:CCGGCAATGACAACATCATGCTAAACTCGAGTTTAGCATGATGTTGTCATTGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000360889    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099276.2-5054s21c1
Sequence:CCGGCTTCATCATGGTGATGCATATCTCGAGATATGCATCACCATGATGAAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002646
VALIDATED
PIK3C2B MISSION shRNA Bacterial Glycerol Stock
phosphatidylinositol-4-phosphate 3-kinase, catalytic subunit type 2 beta
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000194710    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_002646.2-1805s1c1
Sequence:CCGGCAGTCATGAGTACATCCAATACTCGAGTATTGGATGTACTCATGACTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195321    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_002646.2-7427s1c1
Sequence:CCGGCCAGATGAACGGACCATAAATCTCGAGATTTATGGTCCGTTCATCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219671    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_002646.3-2777s1c1
Sequence:CCGGCCGTTGGAGTGCACCTAATTTCTCGAGAAATTAGGTGCACTCCAACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002119    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_002646.x-1672s1c1
Sequence:CCGGCCTCCACTGTAGACTTGCTTACTCGAGTAAGCAAGTCTACAGTGGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219672    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_002646.3-5185s1c1
Sequence:CCGGACAATGAGATGTTGGTATATGCTCGAGCATATACCAACATCTCATTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197168    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_002646.2-1179s1c1
Sequence:CCGGGCAATTACTAGGCTCAACTTGCTCGAGCAAGTTGAGCCTAGTAATTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002120    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_002646.x-6169s1c1
Sequence:CCGGCCTCTTGTCTTCCCTACTTTACTCGAGTAAAGTAGGGAAGACAAGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002121    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_002646.x-2993s1c1
Sequence:CCGGCCTGTGGGAGAAGCGATATTACTCGAGTAATATCGCTTCTCCCACAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002123    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_002646.x-2282s1c1
Sequence:CCGGCAACACATTCAACGCAGACTTCTCGAGAAGTCTGCGTTGAATGTGTTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002122    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_002646.x-1353s1c1
Sequence:CCGGCGCTATGGCAACCGAAAGAATCTCGAGATTCTTTCGGTTGCCATAGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002646
VALIDATED
PIK3C2B MISSION shRNA shRNA Plasmid DNA
phosphatidylinositol-4-phosphate 3-kinase, catalytic subunit type 2 beta
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000194710    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_002646.2-1805s1c1
Sequence:CCGGCAGTCATGAGTACATCCAATACTCGAGTATTGGATGTACTCATGACTGTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000195321    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_002646.2-7427s1c1
Sequence:CCGGCCAGATGAACGGACCATAAATCTCGAGATTTATGGTCCGTTCATCTGGTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000219671    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_002646.3-2777s1c1
Sequence:CCGGCCGTTGGAGTGCACCTAATTTCTCGAGAAATTAGGTGCACTCCAACGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000002119    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_002646.x-1672s1c1
Sequence:CCGGCCTCCACTGTAGACTTGCTTACTCGAGTAAGCAAGTCTACAGTGGAGGTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000219672    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_002646.3-5185s1c1
Sequence:CCGGACAATGAGATGTTGGTATATGCTCGAGCATATACCAACATCTCATTGTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000197168    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_002646.2-1179s1c1
Sequence:CCGGGCAATTACTAGGCTCAACTTGCTCGAGCAAGTTGAGCCTAGTAATTGCTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000002120    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_002646.x-6169s1c1
Sequence:CCGGCCTCTTGTCTTCCCTACTTTACTCGAGTAAAGTAGGGAAGACAAGAGGTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000002121    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_002646.x-2993s1c1
Sequence:CCGGCCTGTGGGAGAAGCGATATTACTCGAGTAATATCGCTTCTCCCACAGGTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000002123    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_002646.x-2282s1c1
Sequence:CCGGCAACACATTCAACGCAGACTTCTCGAGAAGTCTGCGTTGAATGTGTTGTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000002122    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_002646.x-1353s1c1
Sequence:CCGGCGCTATGGCAACCGAAAGAATCTCGAGATTCTTTCGGTTGCCATAGCGTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002646
VALIDATED
PIK3C2B MISSION shRNA Lentiviral Transduction Particles
phosphatidylinositol-4-phosphate 3-kinase, catalytic subunit type 2 beta
Human
10 Products Total
TRC Number Volume Titer/mL Vector Price Set Price (5+)? Select
TRCN0000194710    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_002646.2-1805s1c1
Sequence:CCGGCAGTCATGAGTACATCCAATACTCGAGTATTGGATGTACTCATGACTGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195321    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_002646.2-7427s1c1
Sequence:CCGGCCAGATGAACGGACCATAAATCTCGAGATTTATGGTCCGTTCATCTGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000219671    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_002646.3-2777s1c1
Sequence:CCGGCCGTTGGAGTGCACCTAATTTCTCGAGAAATTAGGTGCACTCCAACGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002119    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_002646.x-1672s1c1
Sequence:CCGGCCTCCACTGTAGACTTGCTTACTCGAGTAAGCAAGTCTACAGTGGAGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000219672    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_002646.3-5185s1c1
Sequence:CCGGACAATGAGATGTTGGTATATGCTCGAGCATATACCAACATCTCATTGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000197168    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_002646.2-1179s1c1
Sequence:CCGGGCAATTACTAGGCTCAACTTGCTCGAGCAAGTTGAGCCTAGTAATTGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002120    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_002646.x-6169s1c1
Sequence:CCGGCCTCTTGTCTTCCCTACTTTACTCGAGTAAAGTAGGGAAGACAAGAGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002121    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_002646.x-2993s1c1
Sequence:CCGGCCTGTGGGAGAAGCGATATTACTCGAGTAATATCGCTTCTCCCACAGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002123    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_002646.x-2282s1c1
Sequence:CCGGCAACACATTCAACGCAGACTTCTCGAGAAGTCTGCGTTGAATGTGTTGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002122    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_002646.x-1353s1c1
Sequence:CCGGCGCTATGGCAACCGAAAGAATCTCGAGATTCTTTCGGTTGCCATAGCGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_136225
PIK3C2B MISSION shRNA Bacterial Glycerol Stock
phosphatidylinositol-4-phosphate 3-kinase, catalytic subunit type 2 beta
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000025019    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_136225.3-1024s1c1
Sequence:CCGGGCCTAATGACATCAACAGTTTCTCGAGAAACTGTTGATGTCATTAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025020    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_136225.3-1797s1c1
Sequence:CCGGGCCATGAGTATATCCAATATTCTCGAGAATATTGGATATACTCATGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025023    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_136225.3-2272s1c1
Sequence:CCGGCAGCACATTCAATGCAGACTTCTCGAGAAGTCTGCATTGAATGTGCTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025022    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_136225.3-1328s1c1
Sequence:CCGGCGAACCTATACTTCTCGATATCTCGAGATATCGAGAAGTATAGGTTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025021    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_136225.3-1153s1c1
Sequence:CCGGCGATGGCATCAATGATGCAATCTCGAGATTGCATCATTGATGCCATCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_136225
PIK3C2B MISSION shRNA shRNA Plasmid DNA
phosphatidylinositol-4-phosphate 3-kinase, catalytic subunit type 2 beta
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000025019    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_136225.3-1024s1c1
Sequence:CCGGGCCTAATGACATCAACAGTTTCTCGAGAAACTGTTGATGTCATTAGGCTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000025020    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_136225.3-1797s1c1
Sequence:CCGGGCCATGAGTATATCCAATATTCTCGAGAATATTGGATATACTCATGGCTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000025023    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_136225.3-2272s1c1
Sequence:CCGGCAGCACATTCAATGCAGACTTCTCGAGAAGTCTGCATTGAATGTGCTGTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000025022    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_136225.3-1328s1c1
Sequence:CCGGCGAACCTATACTTCTCGATATCTCGAGATATCGAGAAGTATAGGTTCGTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000025021    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_136225.3-1153s1c1
Sequence:CCGGCGATGGCATCAATGATGCAATCTCGAGATTGCATCATTGATGCCATCGTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_136225
PIK3C2B MISSION shRNA Lentiviral Transduction Particles
phosphatidylinositol-4-phosphate 3-kinase, catalytic subunit type 2 beta
Mouse
5 Products Total
TRC Number Volume Titer/mL Vector Price Set Price (5+)? Select
TRCN0000025019    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_136225.3-1024s1c1
Sequence:CCGGGCCTAATGACATCAACAGTTTCTCGAGAAACTGTTGATGTCATTAGGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025020    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_136225.3-1797s1c1
Sequence:CCGGGCCATGAGTATATCCAATATTCTCGAGAATATTGGATATACTCATGGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025023    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_136225.3-2272s1c1
Sequence:CCGGCAGCACATTCAATGCAGACTTCTCGAGAAGTCTGCATTGAATGTGCTGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025022    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_136225.3-1328s1c1
Sequence:CCGGCGAACCTATACTTCTCGATATCTCGAGATATCGAGAAGTATAGGTTCGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025021    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_136225.3-1153s1c1
Sequence:CCGGCGATGGCATCAATGATGCAATCTCGAGATTGCATCATTGATGCCATCGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)