EMAIL THIS PAGE TO A FRIEND

PIK3C3

phosphatidylinositol 3-kinase, catalytic subunit type 3

71 Gene Product Result for
Synonyms: VPS34 hVps34
UniProtKB ID: Q8NEB9, Q15134
Gene ID:
Mouse(225326) phosphoinositide-3-kinase, class 3
Rat(65052) phosphatidylinositol 3-kinase, catalytic subunit type 3
Zebrafish(548346) phosphoinositide-3-kinase, class 3
dog(490477) phosphatidylinositol 3-kinase, catalytic subunit type 3
Horse(100053039) phosphatidylinositol 3-kinase, catalytic subunit type 3
domestic cat(101099249) phosphatidylinositol 3-kinase, catalytic subunit type 3
chicken(100857877) phosphoinositide-3-kinase, class 3
cow(534815) phosphatidylinositol 3-kinase, catalytic subunit type 3
sheep(101105709) phosphatidylinositol 3-kinase, catalytic subunit type 3
naked mole-rat(101720820) phosphatidylinositol 3-kinase, catalytic subunit type 3
domestic guinea pig(100729829) phosphatidylinositol 3-kinase, catalytic subunit type 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_181414 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_181414 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_181414 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002647 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002647 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002647 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002647 Rosetta Predictions human pricing
NM_022958 Rosetta Predictions rat pricing
NM_181414 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002647 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00233716 predicted 2317
2 SASI_Hs02_00334179 predicted 1816
3 SASI_Hs02_00334180 predicted 896
4 SASI_Hs01_00233717 predicted 1640
5 SASI_Hs01_00233719 predicted 584
6 SASI_Hs01_00233721 predicted 477
7 SASI_Hs01_00233722 predicted 870
8 SASI_Hs01_00233724 predicted 2762
9 SASI_Hs01_00233725 predicted 1313
10 SASI_Hs02_00334181 predicted 1299
11 SASI_Hs01_00233718 predicted 2748
12 SASI_Hs01_00233720 predicted 1153
13 SASI_Hs01_00233723 predicted 2069
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022958 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00038000 predicted 2290
2 SASI_Rn01_00038001 predicted 2285
3 SASI_Rn02_00263695 predicted 864
4 SASI_Rn01_00038003 predicted 2036
5 SASI_Rn01_00038004 predicted 1562
6 SASI_Rn01_00038005 predicted 640
7 SASI_Rn01_00038006 predicted 291
8 SASI_Rn02_00263696 predicted 2271
9 SASI_Rn01_00038007 predicted 1281
10 SASI_Rn01_00038008 predicted 1490
11 SASI_Rn01_00038002 predicted 267
12 SASI_Rn01_00038009 predicted 250
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181414 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00099413 predicted 2314
2 SASI_Mm01_00099414 predicted 887
3 SASI_Mm01_00099415 predicted 281
4 SASI_Mm01_00099416 predicted 1588
5 SASI_Mm01_00099417 predicted 1516
6 SASI_Mm01_00099418 predicted 2326
7 SASI_Mm01_00099419 predicted 676
8 SASI_Mm01_00099421 predicted 1502
9 SASI_Mm02_00349772 predicted 203
10 SASI_Mm01_00099422 predicted 1213
11 SASI_Mm01_00099420 predicted 1483
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_181414
VALIDATED
PIK3C3 MISSION shRNA Bacterial Glycerol Stock
phosphatidylinositol 3-kinase, catalytic subunit type 3
Mouse
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000382372    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181414.5-279s21c1
Sequence:GTACCGGGAACATCCTACAAGGCGTTTACTCGAGTAAACGCCTTGTAGGATGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380036    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181414.5-2914s21c1
Sequence:GTACCGGAGTAGTCGCTCATCTCTAATTCTCGAGAATTAGAGATGAGCGACTACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380379    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181414.5-210s21c1
Sequence:GTACCGGAGACATGCTCCGACCTCTATGCTCGAGCATAGAGGTCGGAGCATGTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322313    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_181414.5-926s21c1
Sequence:CCGGACCACAAGAGATCAGCTAAATCTCGAGATTTAGCTGATCTCTTGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322375    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_181414.5-367s21c1
Sequence:CCGGCCAAGTGGCCTTGACTATATGCTCGAGCATATAGTCAAGGCCACTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322374    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181414.5-2856s21c1
Sequence:CCGGCTTGCATGCCACTGCTTAAATCTCGAGATTTAAGCAGTGGCATGCAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350673    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181414.5-1510s21c1
Sequence:CCGGGAACTCAACACTGGCTAATTACTCGAGTAATTAGCCAGTGTTGAGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025371    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181414.3-1888s1c1
Sequence:CCGGCCTGTTCAAGAGTGCTCTTATCTCGAGATAAGAGCACTCTTGAACAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025369    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181414.3-2332s1c1
Sequence:CCGGCCATATAGATTTCGGGTATATCTCGAGATATACCCGAAATCTATATGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025373    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_181414.3-1982s1c1
Sequence:CCGGCGTCAAGATCAGCTTATTCTTCTCGAGAAGAATAAGCTGATCTTGACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025370    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181414.3-1311s1c1
Sequence:CCGGCCAAGAAAGATAGTCAAACTTCTCGAGAAGTTTGACTATCTTTCTTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322373    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_181414.5-1979s21c1
Sequence:CCGGCGTCAAGATCAGCTTATTCTTCTCGAGAAGAATAAGCTGATCTTGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000382405    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181414.5-1937s21c1
Sequence:GTACCGGGGAGGCAAATACCCAGTTATTCTCGAGAATAACTGGGTATTTGCCTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025372    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_181414.3-296s1c1
Sequence:CCGGGCGTTTAGTACAAGATGGAATCTCGAGATTCCATCTTGTACTAAACGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_181414
VALIDATED
PIK3C3 MISSION shRNA shRNA Plasmid DNA
phosphatidylinositol 3-kinase, catalytic subunit type 3
Mouse
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000382372    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181414.5-279s21c1
Sequence:GTACCGGGAACATCCTACAAGGCGTTTACTCGAGTAAACGCCTTGTAGGATGTTCTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000380036    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181414.5-2914s21c1
Sequence:GTACCGGAGTAGTCGCTCATCTCTAATTCTCGAGAATTAGAGATGAGCGACTACTTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000380379    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181414.5-210s21c1
Sequence:GTACCGGAGACATGCTCCGACCTCTATGCTCGAGCATAGAGGTCGGAGCATGTCTTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000322313    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_181414.5-926s21c1
Sequence:CCGGACCACAAGAGATCAGCTAAATCTCGAGATTTAGCTGATCTCTTGTGGTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000322375    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_181414.5-367s21c1
Sequence:CCGGCCAAGTGGCCTTGACTATATGCTCGAGCATATAGTCAAGGCCACTTGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000322374    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181414.5-2856s21c1
Sequence:CCGGCTTGCATGCCACTGCTTAAATCTCGAGATTTAAGCAGTGGCATGCAAGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000350673    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181414.5-1510s21c1
Sequence:CCGGGAACTCAACACTGGCTAATTACTCGAGTAATTAGCCAGTGTTGAGTTCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000025371    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181414.3-1888s1c1
Sequence:CCGGCCTGTTCAAGAGTGCTCTTATCTCGAGATAAGAGCACTCTTGAACAGGTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000025369    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181414.3-2332s1c1
Sequence:CCGGCCATATAGATTTCGGGTATATCTCGAGATATACCCGAAATCTATATGGTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000025373    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_181414.3-1982s1c1
Sequence:CCGGCGTCAAGATCAGCTTATTCTTCTCGAGAAGAATAAGCTGATCTTGACGTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000025370    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181414.3-1311s1c1
Sequence:CCGGCCAAGAAAGATAGTCAAACTTCTCGAGAAGTTTGACTATCTTTCTTGGTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000322373    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_181414.5-1979s21c1
Sequence:CCGGCGTCAAGATCAGCTTATTCTTCTCGAGAAGAATAAGCTGATCTTGACGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000382405    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181414.5-1937s21c1
Sequence:GTACCGGGGAGGCAAATACCCAGTTATTCTCGAGAATAACTGGGTATTTGCCTCCTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000025372    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_181414.3-296s1c1
Sequence:CCGGGCGTTTAGTACAAGATGGAATCTCGAGATTCCATCTTGTACTAAACGCTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_181414
VALIDATED
PIK3C3 MISSION shRNA Lentiviral Transduction Particles
phosphatidylinositol 3-kinase, catalytic subunit type 3
Mouse
14 Products Total
TRC Number Volume Titer/mL Vector Price Set Price (5+)? Select
TRCN0000382372    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181414.5-279s21c1
Sequence:GTACCGGGAACATCCTACAAGGCGTTTACTCGAGTAAACGCCTTGTAGGATGTTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380036    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181414.5-2914s21c1
Sequence:GTACCGGAGTAGTCGCTCATCTCTAATTCTCGAGAATTAGAGATGAGCGACTACTTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380379    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181414.5-210s21c1
Sequence:GTACCGGAGACATGCTCCGACCTCTATGCTCGAGCATAGAGGTCGGAGCATGTCTTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000322313    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_181414.5-926s21c1
Sequence:CCGGACCACAAGAGATCAGCTAAATCTCGAGATTTAGCTGATCTCTTGTGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000322375    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_181414.5-367s21c1
Sequence:CCGGCCAAGTGGCCTTGACTATATGCTCGAGCATATAGTCAAGGCCACTTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000322374    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181414.5-2856s21c1
Sequence:CCGGCTTGCATGCCACTGCTTAAATCTCGAGATTTAAGCAGTGGCATGCAAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000350673    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181414.5-1510s21c1
Sequence:CCGGGAACTCAACACTGGCTAATTACTCGAGTAATTAGCCAGTGTTGAGTTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025371    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181414.3-1888s1c1
Sequence:CCGGCCTGTTCAAGAGTGCTCTTATCTCGAGATAAGAGCACTCTTGAACAGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025369    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181414.3-2332s1c1
Sequence:CCGGCCATATAGATTTCGGGTATATCTCGAGATATACCCGAAATCTATATGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025373    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_181414.3-1982s1c1
Sequence:CCGGCGTCAAGATCAGCTTATTCTTCTCGAGAAGAATAAGCTGATCTTGACGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025370    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181414.3-1311s1c1
Sequence:CCGGCCAAGAAAGATAGTCAAACTTCTCGAGAAGTTTGACTATCTTTCTTGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000322373    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_181414.5-1979s21c1
Sequence:CCGGCGTCAAGATCAGCTTATTCTTCTCGAGAAGAATAAGCTGATCTTGACGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000382405    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181414.5-1937s21c1
Sequence:GTACCGGGGAGGCAAATACCCAGTTATTCTCGAGAATAACTGGGTATTTGCCTCCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025372    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_181414.3-296s1c1
Sequence:CCGGGCGTTTAGTACAAGATGGAATCTCGAGATTCCATCTTGTACTAAACGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002647
VALIDATED
PIK3C3 MISSION shRNA Bacterial Glycerol Stock
phosphatidylinositol 3-kinase, catalytic subunit type 3
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000196247    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_002647.2-2776s1c1
Sequence:CCGGGCAACCTTTGTATATTGGAGACTCGAGTCTCCAATATACAAAGGTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196290    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_002647.2-1941s1c1
Sequence:CCGGGAGGCAAATATCCAGTTATATCTCGAGATATAACTGGATATTTGCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196708    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002647.2-634s1c1
Sequence:CCGGGCTGGATAGATTGACATTTAGCTCGAGCTAAATGTCAATCTATCCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196840    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002647.2-1601s1c1
Sequence:CCGGGAGATGTACTTGAACGTAATGCTCGAGCATTACGTTCAAGTACATCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296101    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_002647.2-1601s21c1
Sequence:CCGGGAGATGTACTTGAACGTAATGCTCGAGCATTACGTTCAAGTACATCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000310259    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_002647.2-187s21c1
Sequence:CCGGGTTGAAGTTCTCAGGACTATACTCGAGTATAGTCCTGAGAACTTCAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037794    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_002647.2-930s1c1
Sequence:CCGGCCACGAGAGATCAGTTAAATACTCGAGTATTTAACTGATCTCTCGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196707    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002647.2-187s1c1
Sequence:CCGGGTTGAAGTTCTCAGGACTATACTCGAGTATAGTCCTGAGAACTTCAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037795    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_002647.2-2183s1c1
Sequence:CCGGCCAAGTGAGAATGGGCCAAATCTCGAGATTTGGCCCATTCTCACTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002647.2-2486s1c1
Sequence:CCGGCGAAGGTATTCTAATCTGATTCTCGAGAATCAGATTAGAATACCTTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037797    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002647.2-775s1c1
Sequence:CCGGCGGTGATGAATCATCTCCAATCTCGAGATTGGAGATGATTCATCACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037798    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002647.2-1685s1c1
Sequence:CCGGGCTGCACAACAGACATTTGTACTCGAGTACAAATGTCTGTTGTGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296151    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_002647.2-634s21c1
Sequence:CCGGGCTGGATAGATTGACATTTAGCTCGAGCTAAATGTCAATCTATCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289015    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002647.2-2183s21c1
Sequence:CCGGCCAAGTGAGAATGGGCCAAATCTCGAGATTTGGCCCATTCTCACTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002647
VALIDATED
PIK3C3 MISSION shRNA shRNA Plasmid DNA
phosphatidylinositol 3-kinase, catalytic subunit type 3
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000196247    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_002647.2-2776s1c1
Sequence:CCGGGCAACCTTTGTATATTGGAGACTCGAGTCTCCAATATACAAAGGTTGCTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000196290    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_002647.2-1941s1c1
Sequence:CCGGGAGGCAAATATCCAGTTATATCTCGAGATATAACTGGATATTTGCCTCTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000196708    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002647.2-634s1c1
Sequence:CCGGGCTGGATAGATTGACATTTAGCTCGAGCTAAATGTCAATCTATCCAGCTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000196840    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002647.2-1601s1c1
Sequence:CCGGGAGATGTACTTGAACGTAATGCTCGAGCATTACGTTCAAGTACATCTCTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000296101    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_002647.2-1601s21c1
Sequence:CCGGGAGATGTACTTGAACGTAATGCTCGAGCATTACGTTCAAGTACATCTCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000310259    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_002647.2-187s21c1
Sequence:CCGGGTTGAAGTTCTCAGGACTATACTCGAGTATAGTCCTGAGAACTTCAACTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000037794    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_002647.2-930s1c1
Sequence:CCGGCCACGAGAGATCAGTTAAATACTCGAGTATTTAACTGATCTCTCGTGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000196707    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002647.2-187s1c1
Sequence:CCGGGTTGAAGTTCTCAGGACTATACTCGAGTATAGTCCTGAGAACTTCAACTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000037795    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_002647.2-2183s1c1
Sequence:CCGGCCAAGTGAGAATGGGCCAAATCTCGAGATTTGGCCCATTCTCACTTGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000037796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002647.2-2486s1c1
Sequence:CCGGCGAAGGTATTCTAATCTGATTCTCGAGAATCAGATTAGAATACCTTCGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000037797    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002647.2-775s1c1
Sequence:CCGGCGGTGATGAATCATCTCCAATCTCGAGATTGGAGATGATTCATCACCGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000037798    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002647.2-1685s1c1
Sequence:CCGGGCTGCACAACAGACATTTGTACTCGAGTACAAATGTCTGTTGTGCAGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000296151    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_002647.2-634s21c1
Sequence:CCGGGCTGGATAGATTGACATTTAGCTCGAGCTAAATGTCAATCTATCCAGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000289015    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002647.2-2183s21c1
Sequence:CCGGCCAAGTGAGAATGGGCCAAATCTCGAGATTTGGCCCATTCTCACTTGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002647
VALIDATED
PIK3C3 MISSION shRNA Lentiviral Transduction Particles
phosphatidylinositol 3-kinase, catalytic subunit type 3
Human
14 Products Total
TRC Number Volume Titer/mL Vector Price Set Price (5+)? Select
TRCN0000196247    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_002647.2-2776s1c1
Sequence:CCGGGCAACCTTTGTATATTGGAGACTCGAGTCTCCAATATACAAAGGTTGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196290    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_002647.2-1941s1c1
Sequence:CCGGGAGGCAAATATCCAGTTATATCTCGAGATATAACTGGATATTTGCCTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196708    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002647.2-634s1c1
Sequence:CCGGGCTGGATAGATTGACATTTAGCTCGAGCTAAATGTCAATCTATCCAGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196840    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002647.2-1601s1c1
Sequence:CCGGGAGATGTACTTGAACGTAATGCTCGAGCATTACGTTCAAGTACATCTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000296101    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_002647.2-1601s21c1
Sequence:CCGGGAGATGTACTTGAACGTAATGCTCGAGCATTACGTTCAAGTACATCTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000310259    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_002647.2-187s21c1
Sequence:CCGGGTTGAAGTTCTCAGGACTATACTCGAGTATAGTCCTGAGAACTTCAACTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037794    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_002647.2-930s1c1
Sequence:CCGGCCACGAGAGATCAGTTAAATACTCGAGTATTTAACTGATCTCTCGTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196707    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002647.2-187s1c1
Sequence:CCGGGTTGAAGTTCTCAGGACTATACTCGAGTATAGTCCTGAGAACTTCAACTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037795    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_002647.2-2183s1c1
Sequence:CCGGCCAAGTGAGAATGGGCCAAATCTCGAGATTTGGCCCATTCTCACTTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002647.2-2486s1c1
Sequence:CCGGCGAAGGTATTCTAATCTGATTCTCGAGAATCAGATTAGAATACCTTCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037797    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002647.2-775s1c1
Sequence:CCGGCGGTGATGAATCATCTCCAATCTCGAGATTGGAGATGATTCATCACCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037798    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002647.2-1685s1c1
Sequence:CCGGGCTGCACAACAGACATTTGTACTCGAGTACAAATGTCTGTTGTGCAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000296151    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_002647.2-634s21c1
Sequence:CCGGGCTGGATAGATTGACATTTAGCTCGAGCTAAATGTCAATCTATCCAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000289015    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002647.2-2183s21c1
Sequence:CCGGCCAAGTGAGAATGGGCCAAATCTCGAGATTTGGCCCATTCTCACTTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)