EMAIL THIS PAGE TO A FRIEND

PIK3CA

phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit alpha

172 Gene Product Result for
Synonyms: CLOVE CWS5 MCAP MCM MCMTC PI3K p110-alpha
UniProtKB ID: P42336, Q14CW1, Q99762
Gene ID:
Human(5290) Summary: Phosphatidylinositol 3-kinase is composed of an 85 kDa regulatory subunit and a 110 kDa catalytic subunit. The protein encoded by this gene represents the catalytic subunit, which uses ATP to phosphorylate PtdIns, PtdIns4P and PtdIns(4,5)P2. This gene has been found to be oncogenic and has been implicated in cervical cancers. [provided by RefSeq, Jul 2008]
Mouse(18706) phosphatidylinositol 3-kinase, catalytic, alpha polypeptide
Rat(170911) phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit alpha
domestic guinea pig(100735084) phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit alpha
naked mole-rat(101711934) phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit alpha
cow(282306) phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit alpha
sheep(101110015) phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit alpha
chicken(424971) phosphoinositide-3-kinase, catalytic, alpha polypeptide
domestic cat(101097413) phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit alpha
dog(488084) phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit alpha
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1306184 ANTI-PI3KCA (CENTER) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
immunohistochemistry, western blot pricing
SAB5500163 Anti-PI3KCA antibody, Rabbit monoclonal clone SP139, recombinant, expressed in proprietary host, affinity isolated antibody human (tested)
immunohistochemistry pricing
SAB1306160 ANTI-PI3KCA(C-TERMINAL) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
flow cytometry, immunohistochemistry, western blot pricing
HPA009985 Anti-PIK3CA antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing
SAB2701957 Anti-PIK3CA antibody produced in rabbit human, mouse
immunofluorescence, immunohistochemistry, western blot pricing
SAB2500791 Anti-PIK3CA/P110 α antibody produced in goat affinity isolated antibody, buffered aqueous solution human
ELISA, immunohistochemistry pricing
SAB1306532 ANTI-PK3CA (Y317) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
flow cytometry, immunohistochemistry, western blot pricing
WH0005290M1 Monoclonal Anti-PIK3CA antibody produced in mouse clone 3G3, purified immunoglobulin, buffered aqueous solution human
ELISA, proximity ligation assay pricing
SAB5300225 Monoclonal Anti-PIK3CA antibody produced in mouse clone 4F3, purified immunoglobulin, buffered aqueous solution human
ELISA, flow cytometry, immunofluorescence, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006218 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006218 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006218 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008839 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008839 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008839 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Related Products

Product # Description Species Add to Cart
 
33-04A PI 3-Kinase 3-step HTRF™ Assay Everything you need to perform the PI3 Kinase 3-step HTRF assays (384 wells). pricing
33-047 PI 3-Kinase 3-step HTRF™ Assay The PI 3-Kinase 3-Step HTRF Assay is a high-performance assay kit that provides a universal method for testing all Class I PI3-Kinases in a homogeneous format. pricing
33-036 PI 3-Kinase HTRF™ Assay; 10,000 wells The PI 3-Kinase HTRF Assay is a high-performance assay kit that provides a universal method for testing all Class I PI3-Kinases in a homogeneous format. This pack size has a screening capacity of 10,000 wells. pricing
33-017 PI 3-Kinase HTRF™ Assay; 1920 wells The PI 3-Kinase HTRF Assay is a high-performance assay kit that provides a universal method for testing all Class I PI3-Kinases in a homogeneous format. This pack size has a screening capacity of 5 plates. pricing
33-016 PI 3-Kinase HTRF™ Assay; 385 wells The PI 3-Kinase HTRF Assay is a high-performance assay kit that provides a universal method for testing all Class I PI3-Kinases in a homogeneous format. This pack size has a screening capacity of 1 plate. pricing
33-037 PI 3-Kinase HTRF™ Assay; 50,000 wells The PI 3-Kinase HTRF Assay is a high-performance assay kit that provides a universal method for testing all Class I PI3-Kinases in a homogeneous format. This pack size has a screening capacity of 50,000 wells. pricing
14-782-M PI 3-Kinase (p110α(E542K)/p85α), Human, 10 µg Complex of N-terminal 6His-tagged, recombinant, full-length human p110α containing the mutation E542K & untagged, recombinant, full-length human p85α. For use in Kinase Assays. pricing
14-792-M PI 3-Kinase (p110α(H1047R)/p85α), 10 µg Complex of N-terminal 6His-tagged recombinant human p110α full length, containing the mutation H1047R & untagged, recombinant, human p85α full length. pricing
14-794-M PI 3-Kinase (p110β/p85α) murine, 10 µg Complex of N-terminal 6His-tagged, recombinant murine p110β, full length & untagged, recombinant, murine p85α, full length. pricing
14-783-M PI3 Kinase (p110α(E545K)/p85α), 10 µg Complex of N-terminal 6His-tagged, recombinant, full-length human p110α containing the mutation E545K & untagged, recombinant, full-length human p85α. For use in Kinase Assays. pricing
14-787-M PI3 Kinase (p110α (H1047R)/p85α) Murine, 10 µg Complex of N-terminal 6His-tagged, recombinant, full-length mouse p110α containing the mutation H1047R α & untagged, recombinant, full length mouse p85α. For use in Kinase Assays. pricing
14-790-M PI3 Kinase (p110α/p65α), 10 µg Complex of N-terminal 6His-tagged, recombinant, full-length Human p110α & untagged, recombinant, full length Human p65α. For use in Kinase Assays. pricing
14-785-M PI3 Kinase (p110α/p85α) murine, 10 µg Complex of N-terminal 6His-tagged, recombinant, full-length mouse p110α & untagged, recombinant, full length mouse p85α. Coexpressed by baculovirus in Sf21 insect cells. For use in Kinase Assays. pricing
14-602-M PI3 Kinase (p110α/p85α) Protein, active, 20 µg Active complex of N-terminal His6-tagged recombinant full-length human p110α & untagged, recombinant, full length, human p85α. For use in Kinase Assays. pricing
17-494 PIP3 Quantification TR-FRET Assay The PI3 Kinase Homogenous Cell-Based Assay Kit TR-FRET provides an easy to use method for assaying PIP3 levels by detecting the displacement of biotin-PIP3 from an energy transfer complex. pricing
17-495 PIP3 Quantification TR-FRET Assay The PIP3 Quantification TR-FRET Assay kit provides an easy to use method for assaying PIP3 levels by detecting the displacement of biotin-PIP3 from an energy transfer complex. pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006218 Rosetta Predictions human pricing
XM_001059296 Rosetta Predictions rat pricing
XM_001059350 Rosetta Predictions rat pricing
XM_001059407 Rosetta Predictions rat pricing
XM_001063573 Rosetta Predictions rat pricing
NM_008839 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006218 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00219338 predicted 1693
2 SASI_Hs01_00219339 predicted 2691
3 SASI_Hs01_00219340 predicted 1970
4 SASI_Hs01_00219341 predicted 1644
5 SASI_Hs01_00219342 predicted 3100
6 SASI_Hs01_00219343 predicted 3207
7 SASI_Hs01_00219345 predicted 487
8 SASI_Hs01_00219346 predicted 1063
9 SASI_Hs02_00341129 predicted 1251
10 SASI_Hs02_00341130 predicted 2841
11 SASI_Hs01_00219344 predicted 2656
12 SASI_Hs01_00219347 predicted 1276
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001059296 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00292737 predicted 956
2 SASI_Rn02_00292738 predicted 2517
3 SASI_Rn02_00292739 predicted 2405
4 SASI_Rn02_00292740 predicted 1965
5 SASI_Rn02_00292741 predicted 2802
6 SASI_Rn02_00292742 predicted 1172
7 SASI_Rn02_00292743 predicted 1133
8 SASI_Rn02_00292744 predicted 1142
9 SASI_Rn02_00292745 predicted 1157
10 SASI_Rn02_00292746 predicted 2734
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001059350 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00292923 predicted 1017
2 SASI_Rn02_00292924 predicted 522
3 SASI_Rn02_00292925 predicted 1166
4 SASI_Rn02_00292926 predicted 2886
5 SASI_Rn02_00292927 predicted 2332
6 SASI_Rn02_00292928 predicted 3167
7 SASI_Rn02_00292929 predicted 1535
8 SASI_Rn02_00292930 predicted 1505
9 SASI_Rn02_00292931 predicted 959
10 SASI_Rn02_00292932 predicted 1520
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001059407 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00293086 predicted 526
2 SASI_Rn02_00293087 predicted 2879
3 SASI_Rn02_00293088 predicted 422
4 SASI_Rn02_00293089 predicted 2328
5 SASI_Rn02_00293090 predicted 3173
6 SASI_Rn02_00293091 predicted 1536
7 SASI_Rn02_00293092 predicted 1508
8 SASI_Rn02_00293093 predicted 1522
9 SASI_Rn02_00293094 predicted 3103
10 SASI_Rn02_00293095 predicted 2545
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001063573 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00307654 predicted 2170
2 SASI_Rn02_00307655 predicted 1039
3 SASI_Rn02_00307656 predicted 1259
4 SASI_Rn02_00307657 predicted 1678
5 SASI_Rn02_00307658 predicted 4035
6 SASI_Rn02_00307659 predicted 3488
7 SASI_Rn02_00307660 predicted 2316
8 SASI_Rn02_00307661 predicted 2655
9 SASI_Rn02_00307662 predicted 981
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008839 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00050655 predicted 1817
2 SASI_Mm01_00050657 predicted 468
3 SASI_Mm02_00314776 predicted 2941
4 SASI_Mm01_00050659 predicted 967
5 SASI_Mm02_00314777 predicted 1514
6 SASI_Mm01_00050660 predicted 1895
7 SASI_Mm01_00050661 predicted 2280
8 SASI_Mm01_00050662 predicted 1879
9 SASI_Mm01_00050663 predicted 2419
10 SASI_Mm01_00050664 predicted 1086
11 SASI_Mm01_00050656 predicted 1154
12 SASI_Mm01_00050658 predicted 718
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006218
VALIDATED
PIK3CA MISSION shRNA Bacterial Glycerol Stock
phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit alpha
Human
17 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000039604    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006218.1-2368s1c1
Sequence:CCGGCCAGACATCATGTCAGAGTTACTCGAGTAACTCTGACATGATGTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039605    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006218.1-1057s1c1
Sequence:CCGGCGAGACATTGACAAGATTTATCTCGAGATAAATCTTGTCAATGTCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039606    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006218.1-924s1c1
Sequence:CCGGGCCATCTTATTCCAGACGCATCTCGAGATGCGTCTGGAATAAGATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010406    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006218.x-79s1c1
Sequence:CCGGAATGTTTACTACCAAATGGACTCGAGTCCATTTGGTAGTAAACATTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199985    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006218.2-1639s1c1
Sequence:CCGGGCATGCCAATTGGTCTGTATCCTCGAGGATACAGACCAATTGGCATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195203    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006218.2-1900s1c1
Sequence:CCGGCCAGATGTATTGCTTGGTAAACTCGAGTTTACCAAGCAATACATCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195304    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006218.2-3254s1c1
Sequence:CCGGCAAGAGGCTTTGGAGTATTTCCTCGAGGAAATACTCCAAAGCCTCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196582    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006218.2-3471s1c1
Sequence:CCGGGCATTAGAATTTACAGCAAGACTCGAGTCTTGCTGTAAATTCTAATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196716    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006218.2-1203s1c1
Sequence:CCGGGAGACATTGATAAGATCTATGCTCGAGCATAGATCTTATCAATGTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196795    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006218.2-2892s1c1
Sequence:CCGGGAATTGGAGATCGTCACAATACTCGAGTATTGTGACGATCTCCAATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196951    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006218.2-3455s1c1
Sequence:CCGGGCACAATCCATGAACAGCATTCTCGAGAATGCTGTTCATGGATTGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000382236    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006218.2-2452s21c1
Sequence:GTACCGGGCTTGAAGAGTGTCGAATTATCTCGAGATAATTCGACACTCTTCAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320656    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006218.2-3471s21c1
Sequence:CCGGGCATTAGAATTTACAGCAAGACTCGAGTCTTGCTGTAAATTCTAATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320655    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006218.2-3455s21c1
Sequence:CCGGGCACAATCCATGAACAGCATTCTCGAGAATGCTGTTCATGGATTGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320653    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006218.2-1900s21c1
Sequence:CCGGCCAGATGTATTGCTTGGTAAACTCGAGTTTACCAAGCAATACATCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350275    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006218.2-2892s21c1
Sequence:CCGGGAATTGGAGATCGTCACAATACTCGAGTATTGTGACGATCTCCAATTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350276    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006218.2-2710s21c1
Sequence:CCGGGCGAAATTCTCACACTATTATCTCGAGATAATAGTGTGAGAATTTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006218
VALIDATED
PIK3CA MISSION shRNA shRNA Plasmid DNA
phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit alpha
Human
17 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000039604    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006218.1-2368s1c1
Sequence:CCGGCCAGACATCATGTCAGAGTTACTCGAGTAACTCTGACATGATGTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039605    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006218.1-1057s1c1
Sequence:CCGGCGAGACATTGACAAGATTTATCTCGAGATAAATCTTGTCAATGTCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039606    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006218.1-924s1c1
Sequence:CCGGGCCATCTTATTCCAGACGCATCTCGAGATGCGTCTGGAATAAGATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010406    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006218.x-79s1c1
Sequence:CCGGAATGTTTACTACCAAATGGACTCGAGTCCATTTGGTAGTAAACATTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199985    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006218.2-1639s1c1
Sequence:CCGGGCATGCCAATTGGTCTGTATCCTCGAGGATACAGACCAATTGGCATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195203    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006218.2-1900s1c1
Sequence:CCGGCCAGATGTATTGCTTGGTAAACTCGAGTTTACCAAGCAATACATCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195304    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006218.2-3254s1c1
Sequence:CCGGCAAGAGGCTTTGGAGTATTTCCTCGAGGAAATACTCCAAAGCCTCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196582    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006218.2-3471s1c1
Sequence:CCGGGCATTAGAATTTACAGCAAGACTCGAGTCTTGCTGTAAATTCTAATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196716    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006218.2-1203s1c1
Sequence:CCGGGAGACATTGATAAGATCTATGCTCGAGCATAGATCTTATCAATGTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196795    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006218.2-2892s1c1
Sequence:CCGGGAATTGGAGATCGTCACAATACTCGAGTATTGTGACGATCTCCAATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196951    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006218.2-3455s1c1
Sequence:CCGGGCACAATCCATGAACAGCATTCTCGAGAATGCTGTTCATGGATTGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000382236    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006218.2-2452s21c1
Sequence:GTACCGGGCTTGAAGAGTGTCGAATTATCTCGAGATAATTCGACACTCTTCAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000320656    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006218.2-3471s21c1
Sequence:CCGGGCATTAGAATTTACAGCAAGACTCGAGTCTTGCTGTAAATTCTAATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000320655    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006218.2-3455s21c1
Sequence:CCGGGCACAATCCATGAACAGCATTCTCGAGAATGCTGTTCATGGATTGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000320653    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006218.2-1900s21c1
Sequence:CCGGCCAGATGTATTGCTTGGTAAACTCGAGTTTACCAAGCAATACATCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000350275    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006218.2-2892s21c1
Sequence:CCGGGAATTGGAGATCGTCACAATACTCGAGTATTGTGACGATCTCCAATTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000350276    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006218.2-2710s21c1
Sequence:CCGGGCGAAATTCTCACACTATTATCTCGAGATAATAGTGTGAGAATTTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006218
VALIDATED
PIK3CA MISSION shRNA Lentiviral Transduction Particles
phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit alpha
Human
17 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000039604    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006218.1-2368s1c1
Sequence:CCGGCCAGACATCATGTCAGAGTTACTCGAGTAACTCTGACATGATGTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039605    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006218.1-1057s1c1
Sequence:CCGGCGAGACATTGACAAGATTTATCTCGAGATAAATCTTGTCAATGTCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039606    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006218.1-924s1c1
Sequence:CCGGGCCATCTTATTCCAGACGCATCTCGAGATGCGTCTGGAATAAGATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010406    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006218.x-79s1c1
Sequence:CCGGAATGTTTACTACCAAATGGACTCGAGTCCATTTGGTAGTAAACATTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199985    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006218.2-1639s1c1
Sequence:CCGGGCATGCCAATTGGTCTGTATCCTCGAGGATACAGACCAATTGGCATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195203    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006218.2-1900s1c1
Sequence:CCGGCCAGATGTATTGCTTGGTAAACTCGAGTTTACCAAGCAATACATCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195304    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006218.2-3254s1c1
Sequence:CCGGCAAGAGGCTTTGGAGTATTTCCTCGAGGAAATACTCCAAAGCCTCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196582    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006218.2-3471s1c1
Sequence:CCGGGCATTAGAATTTACAGCAAGACTCGAGTCTTGCTGTAAATTCTAATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196716    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006218.2-1203s1c1
Sequence:CCGGGAGACATTGATAAGATCTATGCTCGAGCATAGATCTTATCAATGTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196795    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006218.2-2892s1c1
Sequence:CCGGGAATTGGAGATCGTCACAATACTCGAGTATTGTGACGATCTCCAATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196951    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006218.2-3455s1c1
Sequence:CCGGGCACAATCCATGAACAGCATTCTCGAGAATGCTGTTCATGGATTGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000382236    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006218.2-2452s21c1
Sequence:GTACCGGGCTTGAAGAGTGTCGAATTATCTCGAGATAATTCGACACTCTTCAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320656    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006218.2-3471s21c1
Sequence:CCGGGCATTAGAATTTACAGCAAGACTCGAGTCTTGCTGTAAATTCTAATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320655    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006218.2-3455s21c1
Sequence:CCGGGCACAATCCATGAACAGCATTCTCGAGAATGCTGTTCATGGATTGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320653    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006218.2-1900s21c1
Sequence:CCGGCCAGATGTATTGCTTGGTAAACTCGAGTTTACCAAGCAATACATCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350275    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006218.2-2892s21c1
Sequence:CCGGGAATTGGAGATCGTCACAATACTCGAGTATTGTGACGATCTCCAATTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350276    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006218.2-2710s21c1
Sequence:CCGGGCGAAATTCTCACACTATTATCTCGAGATAATAGTGTGAGAATTTCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008839
VALIDATED
PIK3CA MISSION shRNA Bacterial Glycerol Stock
phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit alpha
Mouse
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000025614    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008839.1-2719s1c1
Sequence:CCGGGCAACCTTTATCTTGGGAATTCTCGAGAATTCCCAAGATAAAGGTTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025616    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008839.1-1743s1c1
Sequence:CCGGCCAGATGTACTGCTTAGTAAACTCGAGTTTACTAAGCAGTACATCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025615    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008839.1-891s1c1
Sequence:CCGGGCCGATTGATAGCTTCACCATCTCGAGATGGTGAAGCTATCAATCGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025618    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008839.1-1208s1c1
Sequence:CCGGGCCTTTCAATCTGCTCTGTTACTCGAGTAACAGAGCAGATTGAAAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025617    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008839.1-55s1c1
Sequence:CCGGCGAATCCTAGTGGAATGTTTACTCGAGTAAACATTCCACTAGGATTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361343    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008839.2-787s21c1
Sequence:CCGGAGAATATCAGGGCAAGTATATCTCGAGATATACTTGCCCTGATATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361341    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008839.2-3668s21c1
Sequence:CCGGTATAGGTCTGAGTAAGCTAAACTCGAGTTTAGCTTACTCAGACCTATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361413    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008839.2-1953s21c1
Sequence:CCGGTTCAACTTGTACAGGTCTTAACTCGAGTTAAGACCTGTACAAGTTGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218288    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008839.1-1383s21c1
Sequence:GTACCGGTACTGGGTCAAATCCAAATAACTCGAGTTATTTGGATTTGACCCAGTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234003    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008839.1-2295s21c1
Sequence:CCGGGCTTGAAGAGTGTCGAATTATCTCGAGATAATTCGACACTCTTCAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234002    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008839.1-1663s21c1
Sequence:CCGGAGACACTACTGCGTAACTATTCTCGAGAATAGTTACGCAGTAGTGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234001    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008839.1-972s21c1
Sequence:CCGGGAAATCCCTCTGGGTCATAAACTCGAGTTTATGACCCAGAGGGATTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234000    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008839.1-572s21c1
Sequence:CCGGTAGTGGTGATTTGGGTAATAGCTCGAGCTATTACCCAAATCACCACTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008839
VALIDATED
PIK3CA MISSION shRNA shRNA Plasmid DNA
phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit alpha
Mouse
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000025614    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008839.1-2719s1c1
Sequence:CCGGGCAACCTTTATCTTGGGAATTCTCGAGAATTCCCAAGATAAAGGTTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025616    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008839.1-1743s1c1
Sequence:CCGGCCAGATGTACTGCTTAGTAAACTCGAGTTTACTAAGCAGTACATCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025615    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008839.1-891s1c1
Sequence:CCGGGCCGATTGATAGCTTCACCATCTCGAGATGGTGAAGCTATCAATCGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025618    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008839.1-1208s1c1
Sequence:CCGGGCCTTTCAATCTGCTCTGTTACTCGAGTAACAGAGCAGATTGAAAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025617    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008839.1-55s1c1
Sequence:CCGGCGAATCCTAGTGGAATGTTTACTCGAGTAAACATTCCACTAGGATTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000361343    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008839.2-787s21c1
Sequence:CCGGAGAATATCAGGGCAAGTATATCTCGAGATATACTTGCCCTGATATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000361341    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008839.2-3668s21c1
Sequence:CCGGTATAGGTCTGAGTAAGCTAAACTCGAGTTTAGCTTACTCAGACCTATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000361413    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008839.2-1953s21c1
Sequence:CCGGTTCAACTTGTACAGGTCTTAACTCGAGTTAAGACCTGTACAAGTTGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000218288    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008839.1-1383s21c1
Sequence:GTACCGGTACTGGGTCAAATCCAAATAACTCGAGTTATTTGGATTTGACCCAGTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234003    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008839.1-2295s21c1
Sequence:CCGGGCTTGAAGAGTGTCGAATTATCTCGAGATAATTCGACACTCTTCAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234002    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008839.1-1663s21c1
Sequence:CCGGAGACACTACTGCGTAACTATTCTCGAGAATAGTTACGCAGTAGTGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234001    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008839.1-972s21c1
Sequence:CCGGGAAATCCCTCTGGGTCATAAACTCGAGTTTATGACCCAGAGGGATTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234000    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008839.1-572s21c1
Sequence:CCGGTAGTGGTGATTTGGGTAATAGCTCGAGCTATTACCCAAATCACCACTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008839
VALIDATED
PIK3CA MISSION shRNA Lentiviral Transduction Particles
phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit alpha
Mouse
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000025614    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008839.1-2719s1c1
Sequence:CCGGGCAACCTTTATCTTGGGAATTCTCGAGAATTCCCAAGATAAAGGTTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025616    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008839.1-1743s1c1
Sequence:CCGGCCAGATGTACTGCTTAGTAAACTCGAGTTTACTAAGCAGTACATCTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025615    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008839.1-891s1c1
Sequence:CCGGGCCGATTGATAGCTTCACCATCTCGAGATGGTGAAGCTATCAATCGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025618    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008839.1-1208s1c1
Sequence:CCGGGCCTTTCAATCTGCTCTGTTACTCGAGTAACAGAGCAGATTGAAAGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025617    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008839.1-55s1c1
Sequence:CCGGCGAATCCTAGTGGAATGTTTACTCGAGTAAACATTCCACTAGGATTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361343    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008839.2-787s21c1
Sequence:CCGGAGAATATCAGGGCAAGTATATCTCGAGATATACTTGCCCTGATATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361341    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008839.2-3668s21c1
Sequence:CCGGTATAGGTCTGAGTAAGCTAAACTCGAGTTTAGCTTACTCAGACCTATATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361413    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008839.2-1953s21c1
Sequence:CCGGTTCAACTTGTACAGGTCTTAACTCGAGTTAAGACCTGTACAAGTTGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218288    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008839.1-1383s21c1
Sequence:GTACCGGTACTGGGTCAAATCCAAATAACTCGAGTTATTTGGATTTGACCCAGTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234003    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008839.1-2295s21c1
Sequence:CCGGGCTTGAAGAGTGTCGAATTATCTCGAGATAATTCGACACTCTTCAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234002    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008839.1-1663s21c1
Sequence:CCGGAGACACTACTGCGTAACTATTCTCGAGAATAGTTACGCAGTAGTGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234001    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008839.1-972s21c1
Sequence:CCGGGAAATCCCTCTGGGTCATAAACTCGAGTTTATGACCCAGAGGGATTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234000    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008839.1-572s21c1
Sequence:CCGGTAGTGGTGATTTGGGTAATAGCTCGAGCTATTACCCAAATCACCACTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)