EMAIL THIS PAGE TO A FRIEND

PIK3CD

phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit delta

76 Gene Product Result for
Synonyms: P110DELTA PI3K p110D
UniProtKB ID: O00329, A6NCG0, G1FFP1, O15445, Q5SR49
Gene ID:
Human(5293) Summary: Phosphoinositide 3-kinases (PI3Ks) phosphorylate inositol lipids and are involved in the immune response. The protein encoded by this gene is a class I PI3K found primarily in leukocytes. Like other class I PI3Ks (p110-alpha p110-beta, and p110-gamma), the encoded protein binds p85 adapter proteins and GTP-bound RAS. However, unlike the other class I PI3Ks, this protein phosphorylates itself, not p85 protein.[provided by RefSeq, Jul 2010]
Mouse(18707) phosphatidylinositol 3-kinase catalytic delta polypeptide
Rat(366508) phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit delta
domestic guinea pig(100720622) phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit delta
naked mole-rat(101712941) phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit delta
cow(504531) phosphoinositide-3-kinase, catalytic, delta polypeptide
sheep(101117348) phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit delta
Zebrafish(394174) phosphoinositide-3-kinase, catalytic, delta polypeptide
Horse(100051623) phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit delta
domestic cat(101094274) phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit delta
dog(489644) phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit delta
chicken(419444) phosphoinositide-3-kinase, catalytic, delta polypeptide
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005026 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005026 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005026 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008840 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008840 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008840 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005026 Rosetta Predictions human pricing
NM_001108978 Rosetta Predictions rat pricing
NM_001029837 Rosetta Predictions mouse pricing
NM_008840 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005026 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00127787 predicted 537
2 SASI_Hs01_00127788 predicted 254
3 SASI_Hs02_00338804 predicted 3036
4 SASI_Hs02_00338805 predicted 1215
5 SASI_Hs01_00127789 predicted 1985
6 SASI_Hs01_00127790 predicted 403
7 SASI_Hs02_00338806 predicted 616
8 SASI_Hs02_00338807 predicted 2859
9 SASI_Hs01_00127792 predicted 2694
10 SASI_Hs01_00127793 predicted 865
11 SASI_Hs01_00127791 predicted 951
12 SASI_Hs01_00127794 predicted 3002
13 SASI_Hs01_00127795 predicted 933
14 SASI_Hs01_00127796 predicted 540
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108978 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00243964 predicted 1503
2 SASI_Rn02_00243965 predicted 2494
3 SASI_Rn02_00243966 predicted 1332
4 SASI_Rn02_00243967 predicted 1773
5 SASI_Rn02_00243968 predicted 1511
6 SASI_Rn02_00243969 predicted 1168
7 SASI_Rn02_00243970 predicted 922
8 SASI_Rn02_00243971 predicted 560
9 SASI_Rn02_00243972 predicted 3003
10 SASI_Rn02_00243973 predicted 2639
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001029837 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00193530 predicted 3415
2 SASI_Mm02_00288012 predicted 2318
3 SASI_Mm01_00193531 predicted 1414
4 SASI_Mm01_00193532 predicted 1257
5 SASI_Mm01_00193533 predicted 438
6 SASI_Mm01_00193535 predicted 979
7 SASI_Mm01_00193536 predicted 1288
8 SASI_Mm01_00193537 predicted 1995
9 SASI_Mm01_00193539 predicted 2032
10 SASI_Mm02_00288013 predicted 2380
11 SASI_Mm01_00193534 predicted 616
12 SASI_Mm01_00193538 predicted 2178
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008840 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00174508 predicted 3453
2 SASI_Mm02_00314778 predicted 2366
3 SASI_Mm01_00174509 predicted 1461
4 SASI_Mm01_00174510 predicted 1292
5 SASI_Mm01_00174511 predicted 476
6 SASI_Mm01_00174513 predicted 1016
7 SASI_Mm01_00174514 predicted 1330
8 SASI_Mm01_00174515 predicted 2029
9 SASI_Mm01_00174517 predicted 2066
10 SASI_Mm02_00314779 predicted 2420
11 SASI_Mm01_00174512 predicted 656
12 SASI_Mm01_00174516 predicted 2215
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005026
VALIDATED
PIK3CD MISSION shRNA Bacterial Glycerol Stock
phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit delta
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000033275    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_005026.2-3300s1c1
Sequence:CCGGCCACAACGTGTCCAAAGACAACTCGAGTTGTCTTTGGACACGTTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196416    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_005026.2-4536s1c1
Sequence:CCGGGATCTTTCTCTCTGACTATACCTCGAGGTATAGTCAGAGAGAAAGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033274    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_005026.2-2514s1c1
Sequence:CCGGCGTGGGCATCATCTTTAAGAACTCGAGTTCTTAAAGATGATGCCCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033276    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_005026.2-592s1c1
Sequence:CCGGGACCCAGAAGTGAACGACTTTCTCGAGAAAGTCGTTCACTTCTGGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033277    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A3
TRC Version: 1 Clone ID:NM_005026.2-1383s1c1
Sequence:CCGGCGTGATCGAGAAAGCCAAGAACTCGAGTTCTTGGCTTTCTCGATCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033278    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A3
TRC Version: 1 Clone ID:NM_005026.2-2877s1c1
Sequence:CCGGGCACAGCGACAACATCATGATCTCGAGATCATGATGTTGTCGCTGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199099    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A3
TRC Version: 1 Clone ID:NM_005026.2-615s1c1
Sequence:CCGGCGCCAAGATGTGCCAATTCTGCTCGAGCAGAATTGGCACATCTTGGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195551    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1 Clone ID:NM_005026.2-3382s1c1
Sequence:CCGGCCAAGCACATTGGTCCTAAAGCTCGAGCTTTAGGACCAATGTGCTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196921    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: A3
TRC Version: 1 Clone ID:NM_005026.2-4646s1c1
Sequence:CCGGGCCTTCAGAAGCCAACTAACTCTCGAGAGTTAGTTGGCTTCTGAAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200007    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A3
TRC Version: 1 Clone ID:NM_005026.2-1968s1c1
Sequence:CCGGCGTAGGCTCCTTCGCCATCAACTCGAGTTGATGGCGAAGGAGCCTACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005026
VALIDATED
PIK3CD MISSION shRNA shRNA Plasmid DNA
phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit delta
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000033275    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_005026.2-3300s1c1
Sequence:CCGGCCACAACGTGTCCAAAGACAACTCGAGTTGTCTTTGGACACGTTGTGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000196416    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_005026.2-4536s1c1
Sequence:CCGGGATCTTTCTCTCTGACTATACCTCGAGGTATAGTCAGAGAGAAAGATCTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000033274    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_005026.2-2514s1c1
Sequence:CCGGCGTGGGCATCATCTTTAAGAACTCGAGTTCTTAAAGATGATGCCCACGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000033276    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_005026.2-592s1c1
Sequence:CCGGGACCCAGAAGTGAACGACTTTCTCGAGAAAGTCGTTCACTTCTGGGTCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000033277    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A3
TRC Version: 1 Clone ID:NM_005026.2-1383s1c1
Sequence:CCGGCGTGATCGAGAAAGCCAAGAACTCGAGTTCTTGGCTTTCTCGATCACGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000033278    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A3
TRC Version: 1 Clone ID:NM_005026.2-2877s1c1
Sequence:CCGGGCACAGCGACAACATCATGATCTCGAGATCATGATGTTGTCGCTGTGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000199099    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A3
TRC Version: 1 Clone ID:NM_005026.2-615s1c1
Sequence:CCGGCGCCAAGATGTGCCAATTCTGCTCGAGCAGAATTGGCACATCTTGGCGTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000195551    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1 Clone ID:NM_005026.2-3382s1c1
Sequence:CCGGCCAAGCACATTGGTCCTAAAGCTCGAGCTTTAGGACCAATGTGCTTGGTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000196921    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: A3
TRC Version: 1 Clone ID:NM_005026.2-4646s1c1
Sequence:CCGGGCCTTCAGAAGCCAACTAACTCTCGAGAGTTAGTTGGCTTCTGAAGGCTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000200007    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A3
TRC Version: 1 Clone ID:NM_005026.2-1968s1c1
Sequence:CCGGCGTAGGCTCCTTCGCCATCAACTCGAGTTGATGGCGAAGGAGCCTACGTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005026
VALIDATED
PIK3CD MISSION shRNA Lentiviral Transduction Particles
phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit delta
Human
10 Products Total
TRC Number Volume Titer/mL Vector Price Set Price (5+)? Select
TRCN0000033275    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_005026.2-3300s1c1
Sequence:CCGGCCACAACGTGTCCAAAGACAACTCGAGTTGTCTTTGGACACGTTGTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196416    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_005026.2-4536s1c1
Sequence:CCGGGATCTTTCTCTCTGACTATACCTCGAGGTATAGTCAGAGAGAAAGATCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033274    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_005026.2-2514s1c1
Sequence:CCGGCGTGGGCATCATCTTTAAGAACTCGAGTTCTTAAAGATGATGCCCACGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033276    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_005026.2-592s1c1
Sequence:CCGGGACCCAGAAGTGAACGACTTTCTCGAGAAAGTCGTTCACTTCTGGGTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033277    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A3
TRC Version: 1 Clone ID:NM_005026.2-1383s1c1
Sequence:CCGGCGTGATCGAGAAAGCCAAGAACTCGAGTTCTTGGCTTTCTCGATCACGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033278    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A3
TRC Version: 1 Clone ID:NM_005026.2-2877s1c1
Sequence:CCGGGCACAGCGACAACATCATGATCTCGAGATCATGATGTTGTCGCTGTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199099    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A3
TRC Version: 1 Clone ID:NM_005026.2-615s1c1
Sequence:CCGGCGCCAAGATGTGCCAATTCTGCTCGAGCAGAATTGGCACATCTTGGCGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195551    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1 Clone ID:NM_005026.2-3382s1c1
Sequence:CCGGCCAAGCACATTGGTCCTAAAGCTCGAGCTTTAGGACCAATGTGCTTGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196921    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: A3
TRC Version: 1 Clone ID:NM_005026.2-4646s1c1
Sequence:CCGGGCCTTCAGAAGCCAACTAACTCTCGAGAGTTAGTTGGCTTCTGAAGGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000200007    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A3
TRC Version: 1 Clone ID:NM_005026.2-1968s1c1
Sequence:CCGGCGTAGGCTCCTTCGCCATCAACTCGAGTTGATGGCGAAGGAGCCTACGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008840
PIK3CD MISSION shRNA Bacterial Glycerol Stock
phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit delta
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000024648    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008840.1-741s1c1
Sequence:CCGGCGAATACCTCTACGGGAACTACTCGAGTAGTTCCCGTAGAGGTATTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024645    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008840.1-2870s1c1
Sequence:CCGGGCTACTGTGAACGAGCCTATACTCGAGTATAGGCTCGTTCACAGTAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024644    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008840.1-1266s1c1
Sequence:CCGGCCTCATGCTATTCGACTACAACTCGAGTTGTAGTCGAATAGCATGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024646    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008840.1-418s1c1
Sequence:CCGGCGCACTAAGATGCGCCAGTTTCTCGAGAAACTGGCGCATCTTAGTGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361344    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008840.3-1597s21c1
Sequence:CCGGCAGCGACTGGAGTTCGATATCCTCGAGGATATCGAACTCCAGTCGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361415    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008840.3-3809s21c1
Sequence:CCGGAGGAACAGAATAGCCATAAATCTCGAGATTTATGGCTATTCTGTTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361345    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008840.3-2161s21c1
Sequence:CCGGGTGGCCCAGATGCTCTATTTGCTCGAGCAAATAGAGCATCTGGGCCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008840
PIK3CD MISSION shRNA shRNA Plasmid DNA
phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit delta
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000024648    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008840.1-741s1c1
Sequence:CCGGCGAATACCTCTACGGGAACTACTCGAGTAGTTCCCGTAGAGGTATTCGTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000024645    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008840.1-2870s1c1
Sequence:CCGGGCTACTGTGAACGAGCCTATACTCGAGTATAGGCTCGTTCACAGTAGCTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000024644    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008840.1-1266s1c1
Sequence:CCGGCCTCATGCTATTCGACTACAACTCGAGTTGTAGTCGAATAGCATGAGGTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000024646    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008840.1-418s1c1
Sequence:CCGGCGCACTAAGATGCGCCAGTTTCTCGAGAAACTGGCGCATCTTAGTGCGTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000361344    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008840.3-1597s21c1
Sequence:CCGGCAGCGACTGGAGTTCGATATCCTCGAGGATATCGAACTCCAGTCGCTGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000361415    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008840.3-3809s21c1
Sequence:CCGGAGGAACAGAATAGCCATAAATCTCGAGATTTATGGCTATTCTGTTCCTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000361345    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008840.3-2161s21c1
Sequence:CCGGGTGGCCCAGATGCTCTATTTGCTCGAGCAAATAGAGCATCTGGGCCACTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008840
PIK3CD MISSION shRNA Lentiviral Transduction Particles
phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit delta
Mouse
7 Products Total
TRC Number Volume Titer/mL Vector Price Set Price (5+)? Select
TRCN0000024648    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008840.1-741s1c1
Sequence:CCGGCGAATACCTCTACGGGAACTACTCGAGTAGTTCCCGTAGAGGTATTCGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024645    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008840.1-2870s1c1
Sequence:CCGGGCTACTGTGAACGAGCCTATACTCGAGTATAGGCTCGTTCACAGTAGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024644    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008840.1-1266s1c1
Sequence:CCGGCCTCATGCTATTCGACTACAACTCGAGTTGTAGTCGAATAGCATGAGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024646    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008840.1-418s1c1
Sequence:CCGGCGCACTAAGATGCGCCAGTTTCTCGAGAAACTGGCGCATCTTAGTGCGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000361344    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008840.3-1597s21c1
Sequence:CCGGCAGCGACTGGAGTTCGATATCCTCGAGGATATCGAACTCCAGTCGCTGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000361415    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008840.3-3809s21c1
Sequence:CCGGAGGAACAGAATAGCCATAAATCTCGAGATTTATGGCTATTCTGTTCCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000361345    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008840.3-2161s21c1
Sequence:CCGGGTGGCCCAGATGCTCTATTTGCTCGAGCAAATAGAGCATCTGGGCCACTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)