EMAIL THIS PAGE TO A FRIEND

PIK3CG

phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit gamma

87 Gene Product Result for
Synonyms: PI3CG PI3K PI3Kgamma PIK3 p110gamma p120-PI3K
UniProtKB ID: P48736, A4D0Q6, Q8IV23, Q9BZC8
Gene ID:
Human(5294) Summary: This gene encodes a protein that belongs to the pi3/pi4-kinase family of proteins. The gene product is an enzyme that phosphorylates phosphoinositides on the 3-hydroxyl group of the inositol ring. It is an important modulator of extracellular signals, including those elicited by E-cadherin-mediated cell-cell adhesion, which plays an important role in maintenance of the structural and functional integrity of epithelia. In addition to its role in promoting assembly of adherens junctions, the protein is thought to play a pivotal role in the regulation of cytotoxicity in NK cells. The gene is located in a commonly deleted segment of chromosome 7 previously identified in myeloid leukemias. [provided by RefSeq, Jul 2008]
Mouse(30955) phosphoinositide-3-kinase, catalytic, gamma polypeptide
Rat(298947) phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit gamma
Zebrafish(406598) phosphoinositide-3-kinase, catalytic, gamma polypeptide
Zebrafish(564261) phosphoinositide-3-kinase, catalytic, gamma polypeptide
chicken(417706) phosphoinositide-3-kinase, catalytic, gamma polypeptide
dog(483266) phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit gamma
domestic cat(101096215) phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit gamma
cow(530001) phosphoinositide-3-kinase, catalytic, gamma polypeptide
sheep(101102896) phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit gamma
naked mole-rat(101707055) phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit gamma
domestic guinea pig(100725386) phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit gamma
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002649 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002649 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002649 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_020272 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_020272 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_020272 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU081631 MISSION® esiRNA targeting human PIK3CG human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002649 Rosetta Predictions human pricing
NM_001106723 Rosetta Predictions rat pricing
NM_020272 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002649 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00013201 predicted 1603
2 SASI_Hs01_00013202 predicted 1987
3 SASI_Hs01_00013204 predicted 999
4 SASI_Hs01_00013205 predicted 2017
5 SASI_Hs01_00013206 predicted 1079
6 SASI_Hs01_00013207 predicted 3117
7 SASI_Hs01_00013208 predicted 3636
8 SASI_Hs01_00013210 predicted 2842
9 SASI_Hs02_00334183 predicted 770
10 SASI_Hs02_00334184 predicted 3378
11 SASI_Hs01_00013203 predicted 2658
12 SASI_Hs01_00013209 predicted 2666
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106723 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00221758 predicted 2160
2 SASI_Rn02_00221759 predicted 1956
3 SASI_Rn02_00221760 predicted 2327
4 SASI_Rn02_00221761 predicted 1482
5 SASI_Rn02_00221762 predicted 2087
6 SASI_Rn02_00221763 predicted 1822
7 SASI_Rn02_00221764 predicted 1636
8 SASI_Rn02_00221765 predicted 1524
9 SASI_Rn02_00221766 predicted 581
10 SASI_Rn02_00221767 predicted 2078
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020272 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00127267 predicted 2670
2 SASI_Mm01_00127268 predicted 3193
3 SASI_Mm01_00127269 predicted 3382
4 SASI_Mm01_00127270 predicted 2549
5 SASI_Mm02_00325463 predicted 2599
6 SASI_Mm01_00127271 predicted 2438
7 SASI_Mm01_00127272 predicted 2793
8 SASI_Mm02_00325464 predicted 3352
9 SASI_Mm01_00127275 predicted 786
10 SASI_Mm01_00127276 predicted 682
11 SASI_Mm01_00127273 predicted 1117
12 SASI_Mm01_00127274 predicted 3339
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002649
VALIDATED
PIK3CG MISSION shRNA Bacterial Glycerol Stock
phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit gamma
Human
16 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000430313    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002649.2-2853s21c1
Sequence:CCGGTACGAATCATGGAGTCTATTTCTCGAGAAATAGACTCCATGATTCGTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422411    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002649.2-3978s21c1
Sequence:CCGGCATCTGGGTTTAGTCTCAATTCTCGAGAATTGAGACTAAACCCAGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196339    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002649.2-3341s1c1
Sequence:CCGGGACATCTGTGTTAAGGCTTATCTCGAGATAAGCCTTAACACAGATGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196449    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A3
TRC Version: 1 Clone ID:NM_002649.2-2878s1c1
Sequence:CCGGGACTGAATCTTTGGATCTATGCTCGAGCATAGATCCAAAGATTCAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196637    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A3
TRC Version: 1 Clone ID:NM_002649.2-3556s1c1
Sequence:CCGGGCAGTTTAATTGGTTTCTACACTCGAGTGTAGAAACCAATTAAACTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196870    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002649.2-4744s1c1
Sequence:CCGGGCCTTATCCATTTCCCATTTACTCGAGTAAATGGGAAATGGATAAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199330    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A3
TRC Version: 1 Clone ID:NM_002649.2-1601s1c1
Sequence:CCGGCTCCAGATCTACTGCGGTAAACTCGAGTTTACCGCAGTAGATCTGGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195574    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: A3
TRC Version: 1 Clone ID:NM_002649.2-3803s1c1
Sequence:CCGGCAATGTCCAGTGCTAGGATTACTCGAGTAATCCTAGCACTGGACATTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419619    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002649.2-2071s21c1
Sequence:CCGGAGCATATCCTAAGCTATTTAGCTCGAGCTAAATAGCTTAGGATATGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421699    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002649.2-3644s21c1
Sequence:CCGGAGTTAGTGTTCTATGGTTTAACTCGAGTTAAACCATAGAACACTAACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421875    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002649.2-2954s21c1
Sequence:CCGGGTGAAAGACGCCACGACAATTCTCGAGAATTGTCGTGGCGTCTTTCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033279    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002649.2-3122s1c1
Sequence:CCGGGCAACCTTTGTTCTTGGAATACTCGAGTATTCCAAGAACAAAGGTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033281    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002649.2-2774s1c1
Sequence:CCGGGCCCTATCAAATGAAACAATTCTCGAGAATTGTTTCATTTGATAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033283    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002649.2-940s1c1
Sequence:CCGGCCTGTGGAAGAAGATTGCCAACTCGAGTTGGCAATCTTCTTCCACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033280    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A3
TRC Version: 1 Clone ID:NM_002649.2-1045s1c1
Sequence:CCGGGCAGAGCTTCTTCACCAAGATCTCGAGATCTTGGTGAAGAAGCTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414541    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002649.2-3862s21c1
Sequence:CCGGGGAGAATATTCTCGGTTTAAACTCGAGTTTAAACCGAGAATATTCTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002649
VALIDATED
PIK3CG MISSION shRNA shRNA Plasmid DNA
phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit gamma
Human
16 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000430313    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002649.2-2853s21c1
Sequence:CCGGTACGAATCATGGAGTCTATTTCTCGAGAAATAGACTCCATGATTCGTATTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000422411    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002649.2-3978s21c1
Sequence:CCGGCATCTGGGTTTAGTCTCAATTCTCGAGAATTGAGACTAAACCCAGATGTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000196339    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002649.2-3341s1c1
Sequence:CCGGGACATCTGTGTTAAGGCTTATCTCGAGATAAGCCTTAACACAGATGTCTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000196449    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A3
TRC Version: 1 Clone ID:NM_002649.2-2878s1c1
Sequence:CCGGGACTGAATCTTTGGATCTATGCTCGAGCATAGATCCAAAGATTCAGTCTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000196637    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A3
TRC Version: 1 Clone ID:NM_002649.2-3556s1c1
Sequence:CCGGGCAGTTTAATTGGTTTCTACACTCGAGTGTAGAAACCAATTAAACTGCTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000196870    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002649.2-4744s1c1
Sequence:CCGGGCCTTATCCATTTCCCATTTACTCGAGTAAATGGGAAATGGATAAGGCTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000199330    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A3
TRC Version: 1 Clone ID:NM_002649.2-1601s1c1
Sequence:CCGGCTCCAGATCTACTGCGGTAAACTCGAGTTTACCGCAGTAGATCTGGAGTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000195574    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: A3
TRC Version: 1 Clone ID:NM_002649.2-3803s1c1
Sequence:CCGGCAATGTCCAGTGCTAGGATTACTCGAGTAATCCTAGCACTGGACATTGTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000419619    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002649.2-2071s21c1
Sequence:CCGGAGCATATCCTAAGCTATTTAGCTCGAGCTAAATAGCTTAGGATATGCTTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000421699    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002649.2-3644s21c1
Sequence:CCGGAGTTAGTGTTCTATGGTTTAACTCGAGTTAAACCATAGAACACTAACTTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000421875    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002649.2-2954s21c1
Sequence:CCGGGTGAAAGACGCCACGACAATTCTCGAGAATTGTCGTGGCGTCTTTCACTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000033279    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002649.2-3122s1c1
Sequence:CCGGGCAACCTTTGTTCTTGGAATACTCGAGTATTCCAAGAACAAAGGTTGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000033281    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002649.2-2774s1c1
Sequence:CCGGGCCCTATCAAATGAAACAATTCTCGAGAATTGTTTCATTTGATAGGGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000033283    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002649.2-940s1c1
Sequence:CCGGCCTGTGGAAGAAGATTGCCAACTCGAGTTGGCAATCTTCTTCCACAGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000033280    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A3
TRC Version: 1 Clone ID:NM_002649.2-1045s1c1
Sequence:CCGGGCAGAGCTTCTTCACCAAGATCTCGAGATCTTGGTGAAGAAGCTCTGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000414541    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002649.2-3862s21c1
Sequence:CCGGGGAGAATATTCTCGGTTTAAACTCGAGTTTAAACCGAGAATATTCTCCTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002649
VALIDATED
PIK3CG MISSION shRNA Lentiviral Transduction Particles
phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit gamma
Human
16 Products Total
TRC Number Volume Titer/mL Vector Price Set Price (5+)? Select
TRCN0000430313    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002649.2-2853s21c1
Sequence:CCGGTACGAATCATGGAGTCTATTTCTCGAGAAATAGACTCCATGATTCGTATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422411    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002649.2-3978s21c1
Sequence:CCGGCATCTGGGTTTAGTCTCAATTCTCGAGAATTGAGACTAAACCCAGATGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196339    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002649.2-3341s1c1
Sequence:CCGGGACATCTGTGTTAAGGCTTATCTCGAGATAAGCCTTAACACAGATGTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196449    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A3
TRC Version: 1 Clone ID:NM_002649.2-2878s1c1
Sequence:CCGGGACTGAATCTTTGGATCTATGCTCGAGCATAGATCCAAAGATTCAGTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196637    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A3
TRC Version: 1 Clone ID:NM_002649.2-3556s1c1
Sequence:CCGGGCAGTTTAATTGGTTTCTACACTCGAGTGTAGAAACCAATTAAACTGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196870    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002649.2-4744s1c1
Sequence:CCGGGCCTTATCCATTTCCCATTTACTCGAGTAAATGGGAAATGGATAAGGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199330    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A3
TRC Version: 1 Clone ID:NM_002649.2-1601s1c1
Sequence:CCGGCTCCAGATCTACTGCGGTAAACTCGAGTTTACCGCAGTAGATCTGGAGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195574    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: A3
TRC Version: 1 Clone ID:NM_002649.2-3803s1c1
Sequence:CCGGCAATGTCCAGTGCTAGGATTACTCGAGTAATCCTAGCACTGGACATTGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419619    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002649.2-2071s21c1
Sequence:CCGGAGCATATCCTAAGCTATTTAGCTCGAGCTAAATAGCTTAGGATATGCTTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421699    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002649.2-3644s21c1
Sequence:CCGGAGTTAGTGTTCTATGGTTTAACTCGAGTTAAACCATAGAACACTAACTTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421875    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002649.2-2954s21c1
Sequence:CCGGGTGAAAGACGCCACGACAATTCTCGAGAATTGTCGTGGCGTCTTTCACTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033279    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002649.2-3122s1c1
Sequence:CCGGGCAACCTTTGTTCTTGGAATACTCGAGTATTCCAAGAACAAAGGTTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033281    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002649.2-2774s1c1
Sequence:CCGGGCCCTATCAAATGAAACAATTCTCGAGAATTGTTTCATTTGATAGGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033283    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002649.2-940s1c1
Sequence:CCGGCCTGTGGAAGAAGATTGCCAACTCGAGTTGGCAATCTTCTTCCACAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033280    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A3
TRC Version: 1 Clone ID:NM_002649.2-1045s1c1
Sequence:CCGGGCAGAGCTTCTTCACCAAGATCTCGAGATCTTGGTGAAGAAGCTCTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414541    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002649.2-3862s21c1
Sequence:CCGGGGAGAATATTCTCGGTTTAAACTCGAGTTTAAACCGAGAATATTCTCCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020272
PIK3CG MISSION shRNA Bacterial Glycerol Stock
phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit gamma
Mouse
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000232404    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020272.1-3927s21c1
Sequence:CCGGGACGATCTCGTATTGAGTATCCTCGAGGATACTCAATACGAGATCGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232403    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020272.1-2702s21c1
Sequence:CCGGGTACCCTGGTGATCGAGAAATCTCGAGATTTCTCGATCACCAGGGTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232402    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020272.1-2593s21c1
Sequence:CCGGGACGTCAGTTCCCAAGTTATTCTCGAGAATAACTTGGGAACTGACGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232401    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020272.1-1995s21c1
Sequence:CCGGCATAGCCACAGATCCACTTAACTCGAGTTAAGTGGATCTGTGGCTATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361704    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020272.2-3990s21c1
Sequence:CCGGCTCGTGTGTCCACCATGTATTCTCGAGAATACATGGTGGACACACGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361735    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020272.2-2973s21c1
Sequence:CCGGTGCCACAACGATCGCTCAAATCTCGAGATTTGAGCGATCGTTGTGGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000368732    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020272.2-2864s21c1
Sequence:CCGGTACGCATCATGGAGTCCATTTCTCGAGAAATGGACTCCATGATGCGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024572    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020272.1-1719s1c1
Sequence:CCGGGCTGTTAATAGACCACCGTTTCTCGAGAAACGGTGGTCTATTAACAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024569    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020272.1-1091s1c1
Sequence:CCGGCCCTAATGAATATCCCAGAAACTCGAGTTTCTGGGATATTCATTAGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024570    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020272.1-684s1c1
Sequence:CCGGCCTGCATTACTGGAAGTTGATCTCGAGATCAACTTCCAGTAATGCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024573    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020272.1-2780s1c1
Sequence:CCGGCCACAGTCCTATCCAACGAAACTCGAGTTTCGTTGGATAGGACTGTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024571    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020272.1-2603s1c1
Sequence:CCGGCCCAAGTTATTTCACAGCTTACTCGAGTAAGCTGTGAAATAACTTGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361703    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020272.2-1410s21c1
Sequence:CCGGCAAGATCAGAGGCATTGATATCTCGAGATATCAATGCCTCTGATCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020272
PIK3CG MISSION shRNA shRNA Plasmid DNA
phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit gamma
Mouse
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000232404    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020272.1-3927s21c1
Sequence:CCGGGACGATCTCGTATTGAGTATCCTCGAGGATACTCAATACGAGATCGTCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000232403    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020272.1-2702s21c1
Sequence:CCGGGTACCCTGGTGATCGAGAAATCTCGAGATTTCTCGATCACCAGGGTACTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000232402    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020272.1-2593s21c1
Sequence:CCGGGACGTCAGTTCCCAAGTTATTCTCGAGAATAACTTGGGAACTGACGTCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000232401    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020272.1-1995s21c1
Sequence:CCGGCATAGCCACAGATCCACTTAACTCGAGTTAAGTGGATCTGTGGCTATGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000361704    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020272.2-3990s21c1
Sequence:CCGGCTCGTGTGTCCACCATGTATTCTCGAGAATACATGGTGGACACACGAGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000361735    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020272.2-2973s21c1
Sequence:CCGGTGCCACAACGATCGCTCAAATCTCGAGATTTGAGCGATCGTTGTGGCATTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000368732    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020272.2-2864s21c1
Sequence:CCGGTACGCATCATGGAGTCCATTTCTCGAGAAATGGACTCCATGATGCGTATTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000024572    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020272.1-1719s1c1
Sequence:CCGGGCTGTTAATAGACCACCGTTTCTCGAGAAACGGTGGTCTATTAACAGCTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000024569    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020272.1-1091s1c1
Sequence:CCGGCCCTAATGAATATCCCAGAAACTCGAGTTTCTGGGATATTCATTAGGGTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000024570    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020272.1-684s1c1
Sequence:CCGGCCTGCATTACTGGAAGTTGATCTCGAGATCAACTTCCAGTAATGCAGGTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000024573    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020272.1-2780s1c1
Sequence:CCGGCCACAGTCCTATCCAACGAAACTCGAGTTTCGTTGGATAGGACTGTGGTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000024571    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020272.1-2603s1c1
Sequence:CCGGCCCAAGTTATTTCACAGCTTACTCGAGTAAGCTGTGAAATAACTTGGGTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000361703    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020272.2-1410s21c1
Sequence:CCGGCAAGATCAGAGGCATTGATATCTCGAGATATCAATGCCTCTGATCTTGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020272
PIK3CG MISSION shRNA Lentiviral Transduction Particles
phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit gamma
Mouse
13 Products Total
TRC Number Volume Titer/mL Vector Price Set Price (5+)? Select
TRCN0000232404    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020272.1-3927s21c1
Sequence:CCGGGACGATCTCGTATTGAGTATCCTCGAGGATACTCAATACGAGATCGTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232403    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020272.1-2702s21c1
Sequence:CCGGGTACCCTGGTGATCGAGAAATCTCGAGATTTCTCGATCACCAGGGTACTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232402    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020272.1-2593s21c1
Sequence:CCGGGACGTCAGTTCCCAAGTTATTCTCGAGAATAACTTGGGAACTGACGTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232401    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020272.1-1995s21c1
Sequence:CCGGCATAGCCACAGATCCACTTAACTCGAGTTAAGTGGATCTGTGGCTATGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000361704    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020272.2-3990s21c1
Sequence:CCGGCTCGTGTGTCCACCATGTATTCTCGAGAATACATGGTGGACACACGAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000361735    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020272.2-2973s21c1
Sequence:CCGGTGCCACAACGATCGCTCAAATCTCGAGATTTGAGCGATCGTTGTGGCATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000368732    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020272.2-2864s21c1
Sequence:CCGGTACGCATCATGGAGTCCATTTCTCGAGAAATGGACTCCATGATGCGTATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024572    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020272.1-1719s1c1
Sequence:CCGGGCTGTTAATAGACCACCGTTTCTCGAGAAACGGTGGTCTATTAACAGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024569    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020272.1-1091s1c1
Sequence:CCGGCCCTAATGAATATCCCAGAAACTCGAGTTTCTGGGATATTCATTAGGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024570    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020272.1-684s1c1
Sequence:CCGGCCTGCATTACTGGAAGTTGATCTCGAGATCAACTTCCAGTAATGCAGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024573    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020272.1-2780s1c1
Sequence:CCGGCCACAGTCCTATCCAACGAAACTCGAGTTTCGTTGGATAGGACTGTGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024571    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020272.1-2603s1c1
Sequence:CCGGCCCAAGTTATTTCACAGCTTACTCGAGTAAGCTGTGAAATAACTTGGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000361703    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020272.2-1410s21c1
Sequence:CCGGCAAGATCAGAGGCATTGATATCTCGAGATATCAATGCCTCTGATCTTGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)