EMAIL THIS PAGE TO A FRIEND

PIK3IP1

phosphoinositide-3-kinase interacting protein 1

41 Gene Product Result for
Synonyms: HGFL hHGFL(S)
UniProtKB ID: Q96FE7, B4DRR9, O00318, Q49A94, Q86YW2, Q8NCJ9
Gene ID:
Mouse(216505) phosphoinositide-3-kinase interacting protein 1
Rat(305472) phosphoinositide-3-kinase interacting protein 1
domestic guinea pig(100730681) phosphoinositide-3-kinase interacting protein 1
naked mole-rat(101698713) phosphoinositide-3-kinase interacting protein 1
cow(512082) phosphoinositide-3-kinase interacting protein 1
sheep(101115232) phosphoinositide-3-kinase interacting protein 1
Zebrafish(386643) phosphoinositide-3-kinase interacting protein 1
chicken(416964) phosphoinositide-3-kinase interacting protein 1
dog(486364) phosphoinositide-3-kinase interacting protein 1
domestic cat(101097180) phosphoinositide-3-kinase interacting protein 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_052880 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_052880 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_052880 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_178149 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178149 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178149 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU017281 MISSION® esiRNA esiRNA targeting human PIK3IP1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_052880 Rosetta Predictions human pricing
NM_001017453 Rosetta Predictions rat pricing
NM_178149 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_052880 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00222092 predicted 792
2 SASI_Hs01_00222093 predicted 658
3 SASI_Hs01_00222094 predicted 819
4 SASI_Hs01_00222095 predicted 335
5 SASI_Hs01_00222096 predicted 509
6 SASI_Hs01_00222097 predicted 510
7 SASI_Hs01_00222098 predicted 498
8 SASI_Hs01_00222099 predicted 472
9 SASI_Hs01_00222100 predicted 1056
10 SASI_Hs01_00222101 predicted 614
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001017453 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00202248 predicted 1166
2 SASI_Rn02_00202249 predicted 1350
3 SASI_Rn01_00097086 predicted 783
4 SASI_Rn01_00097087 predicted 1168
5 SASI_Rn01_00097088 predicted 914
6 SASI_Rn01_00097089 predicted 1009
7 SASI_Rn01_00097090 predicted 1224
8 SASI_Rn01_00097091 predicted 1156
9 SASI_Rn01_00097093 predicted 920
10 SASI_Rn01_00097094 predicted 1124
11 SASI_Rn01_00097092 predicted 1193
12 SASI_Rn01_00097095 predicted 923
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178149 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00078015 predicted 1053
2 SASI_Mm01_00078014 predicted 1142
3 SASI_Mm01_00078016 predicted 1048
4 SASI_Mm01_00078017 predicted 640
5 SASI_Mm01_00078018 predicted 719
6 SASI_Mm01_00078019 predicted 1382
7 SASI_Mm01_00078020 predicted 1266
8 SASI_Mm01_00078021 predicted 1235
9 SASI_Mm01_00078022 predicted 1487
10 SASI_Mm01_00078023 predicted 745
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_052880
PIK3IP1 MISSION shRNA Bacterial Glycerol Stock
phosphoinositide-3-kinase interacting protein 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000431594    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_052880.4-1374s21c1
Sequence:CCGGACACTGTTATTCATGGTTAAGCTCGAGCTTAACCATGAATAACAGTGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138560    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_052880.3-2157s1c1
Sequence:CCGGCCTAGCCATAGAGCTTCCTTTCTCGAGAAAGGAAGCTCTATGGCTAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135363    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052880.3-762s1c1
Sequence:CCGGGAAAGTATGTGAGAGGGAGATCTCGAGATCTCCCTCTCACATACTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137987    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052880.3-679s1c1
Sequence:CCGGGTGATCATCATTGCCATCGGACTCGAGTCCGATGGCAATGATGATCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134137    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_052880.3-1011s1c1
Sequence:CCGGCCACTTTGTGTTCTGGTTAAACTCGAGTTTAACCAGAACACAAAGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000133917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052880.3-666s1c1
Sequence:CCGGCATTACCATGATGGTGATCATCTCGAGATGATCACCATCATGGTAATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135429    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052880.3-675s1c1
Sequence:CCGGGATGGTGATCATCATTGCCATCTCGAGATGGCAATGATGATCACCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000133982    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_052880.3-1569s1c1
Sequence:CCGGCCTGTTTCATAAGGAAAGGAACTCGAGTTCCTTTCCTTATGAAACAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437651    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052880.4-701s21c1
Sequence:CCGGTACGTGCTGGGCATTACCATGCTCGAGCATGGTAATGCCCAGCACGTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433774    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052880.4-533s21c1
Sequence:CCGGGAAATCCAGGAAGCGTCTGAACTCGAGTTCAGACGCTTCCTGGATTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_052880
PIK3IP1 MISSION shRNA shRNA Plasmid DNA
phosphoinositide-3-kinase interacting protein 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000431594    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_052880.4-1374s21c1
Sequence:CCGGACACTGTTATTCATGGTTAAGCTCGAGCTTAACCATGAATAACAGTGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000138560    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_052880.3-2157s1c1
Sequence:CCGGCCTAGCCATAGAGCTTCCTTTCTCGAGAAAGGAAGCTCTATGGCTAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135363    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052880.3-762s1c1
Sequence:CCGGGAAAGTATGTGAGAGGGAGATCTCGAGATCTCCCTCTCACATACTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000137987    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052880.3-679s1c1
Sequence:CCGGGTGATCATCATTGCCATCGGACTCGAGTCCGATGGCAATGATGATCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134137    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_052880.3-1011s1c1
Sequence:CCGGCCACTTTGTGTTCTGGTTAAACTCGAGTTTAACCAGAACACAAAGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000133917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052880.3-666s1c1
Sequence:CCGGCATTACCATGATGGTGATCATCTCGAGATGATCACCATCATGGTAATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135429    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052880.3-675s1c1
Sequence:CCGGGATGGTGATCATCATTGCCATCTCGAGATGGCAATGATGATCACCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000133982    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_052880.3-1569s1c1
Sequence:CCGGCCTGTTTCATAAGGAAAGGAACTCGAGTTCCTTTCCTTATGAAACAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000437651    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052880.4-701s21c1
Sequence:CCGGTACGTGCTGGGCATTACCATGCTCGAGCATGGTAATGCCCAGCACGTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000433774    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052880.4-533s21c1
Sequence:CCGGGAAATCCAGGAAGCGTCTGAACTCGAGTTCAGACGCTTCCTGGATTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_052880
PIK3IP1 MISSION shRNA Lentiviral Transduction Particles
phosphoinositide-3-kinase interacting protein 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000431594    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_052880.4-1374s21c1
Sequence:CCGGACACTGTTATTCATGGTTAAGCTCGAGCTTAACCATGAATAACAGTGTTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000138560    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_052880.3-2157s1c1
Sequence:CCGGCCTAGCCATAGAGCTTCCTTTCTCGAGAAAGGAAGCTCTATGGCTAGGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000135363    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052880.3-762s1c1
Sequence:CCGGGAAAGTATGTGAGAGGGAGATCTCGAGATCTCCCTCTCACATACTTTCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000137987    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052880.3-679s1c1
Sequence:CCGGGTGATCATCATTGCCATCGGACTCGAGTCCGATGGCAATGATGATCACTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000134137    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_052880.3-1011s1c1
Sequence:CCGGCCACTTTGTGTTCTGGTTAAACTCGAGTTTAACCAGAACACAAAGTGGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000133917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052880.3-666s1c1
Sequence:CCGGCATTACCATGATGGTGATCATCTCGAGATGATCACCATCATGGTAATGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000135429    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052880.3-675s1c1
Sequence:CCGGGATGGTGATCATCATTGCCATCTCGAGATGGCAATGATGATCACCATCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000133982    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_052880.3-1569s1c1
Sequence:CCGGCCTGTTTCATAAGGAAAGGAACTCGAGTTCCTTTCCTTATGAAACAGGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000437651    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052880.4-701s21c1
Sequence:CCGGTACGTGCTGGGCATTACCATGCTCGAGCATGGTAATGCCCAGCACGTATTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000433774    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052880.4-533s21c1
Sequence:CCGGGAAATCCAGGAAGCGTCTGAACTCGAGTTCAGACGCTTCCTGGATTTCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178149
PIK3IP1 MISSION shRNA Bacterial Glycerol Stock
phosphoinositide-3-kinase interacting protein 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000375597    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178149.4-567s21c1
Sequence:CCGGTGGTGCACCAGGTGACAAAGACTCGAGTCTTTGTCACCTGGTGCACCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249991    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178149.4-718s21c1
Sequence:CCGGTACGTGCTGGGCATTACTATGCTCGAGCATAGTAATGCCCAGCACGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179290    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178149.2-1138s1c1
Sequence:CCGGGAAAGAGCAACATGAGAAGAACTCGAGTTCTTCTCATGTTGCTCTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184438    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178149.2-1054s1c1
Sequence:CCGGGCTGGGCATTACTATGATGGTCTCGAGACCATCATAGTAATGCCCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184737    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178149.2-1707s1c1
Sequence:CCGGCCATTCGTCATCCAGGAACTTCTCGAGAAGTTCCTGGATGACGAATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249989    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178149.4-769s21c1
Sequence:CCGGATTATCGTGGGCTACACTTACCTCGAGGTAAGTGTAGCCCACGATAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249990    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178149.4-740s21c1
Sequence:CCGGTGGTGATCATCCTCGCTATTGCTCGAGCAATAGCGAGGATGATCACCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345857    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178149.4-817s21c1
Sequence:CCGGCATGAGAAGAAAGCGTGTGAGCTCGAGCTCACACGCTTTCTTCTCATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375598    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178149.4-841s21c1
Sequence:CCGGGAGATGCAGCGAATCACCTTGCTCGAGCAAGGTGATTCGCTGCATCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379268    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178149.4-1389s21c1
Sequence:CCGGAGGAACTTGAGTGGCATATACCTCGAGGTATATGCCACTCAAGTTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178149
PIK3IP1 MISSION shRNA shRNA Plasmid DNA
phosphoinositide-3-kinase interacting protein 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000375597    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178149.4-567s21c1
Sequence:CCGGTGGTGCACCAGGTGACAAAGACTCGAGTCTTTGTCACCTGGTGCACCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249991    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178149.4-718s21c1
Sequence:CCGGTACGTGCTGGGCATTACTATGCTCGAGCATAGTAATGCCCAGCACGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179290    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178149.2-1138s1c1
Sequence:CCGGGAAAGAGCAACATGAGAAGAACTCGAGTTCTTCTCATGTTGCTCTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000184438    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178149.2-1054s1c1
Sequence:CCGGGCTGGGCATTACTATGATGGTCTCGAGACCATCATAGTAATGCCCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000184737    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178149.2-1707s1c1
Sequence:CCGGCCATTCGTCATCCAGGAACTTCTCGAGAAGTTCCTGGATGACGAATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249989    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178149.4-769s21c1
Sequence:CCGGATTATCGTGGGCTACACTTACCTCGAGGTAAGTGTAGCCCACGATAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249990    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178149.4-740s21c1
Sequence:CCGGTGGTGATCATCCTCGCTATTGCTCGAGCAATAGCGAGGATGATCACCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000345857    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178149.4-817s21c1
Sequence:CCGGCATGAGAAGAAAGCGTGTGAGCTCGAGCTCACACGCTTTCTTCTCATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000375598    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178149.4-841s21c1
Sequence:CCGGGAGATGCAGCGAATCACCTTGCTCGAGCAAGGTGATTCGCTGCATCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000379268    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178149.4-1389s21c1
Sequence:CCGGAGGAACTTGAGTGGCATATACCTCGAGGTATATGCCACTCAAGTTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178149
PIK3IP1 MISSION shRNA Lentiviral Transduction Particles
phosphoinositide-3-kinase interacting protein 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000375597    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178149.4-567s21c1
Sequence:CCGGTGGTGCACCAGGTGACAAAGACTCGAGTCTTTGTCACCTGGTGCACCATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000249991    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178149.4-718s21c1
Sequence:CCGGTACGTGCTGGGCATTACTATGCTCGAGCATAGTAATGCCCAGCACGTATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000179290    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178149.2-1138s1c1
Sequence:CCGGGAAAGAGCAACATGAGAAGAACTCGAGTTCTTCTCATGTTGCTCTTTCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000184438    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178149.2-1054s1c1
Sequence:CCGGGCTGGGCATTACTATGATGGTCTCGAGACCATCATAGTAATGCCCAGCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000184737    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178149.2-1707s1c1
Sequence:CCGGCCATTCGTCATCCAGGAACTTCTCGAGAAGTTCCTGGATGACGAATGGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000249989    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178149.4-769s21c1
Sequence:CCGGATTATCGTGGGCTACACTTACCTCGAGGTAAGTGTAGCCCACGATAATTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000249990    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178149.4-740s21c1
Sequence:CCGGTGGTGATCATCCTCGCTATTGCTCGAGCAATAGCGAGGATGATCACCATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000345857    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178149.4-817s21c1
Sequence:CCGGCATGAGAAGAAAGCGTGTGAGCTCGAGCTCACACGCTTTCTTCTCATGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000375598    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178149.4-841s21c1
Sequence:CCGGGAGATGCAGCGAATCACCTTGCTCGAGCAAGGTGATTCGCTGCATCTCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000379268    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178149.4-1389s21c1
Sequence:CCGGAGGAACTTGAGTGGCATATACCTCGAGGTATATGCCACTCAAGTTCCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???