EMAIL THIS PAGE TO A FRIEND

PIK3R1

phosphoinositide-3-kinase, regulatory subunit 1 (alpha)

266 Gene Product Result for
Synonyms: AGM7 GRB1 p85 p85-ALPHA
Gene ID:
Human(5295) Summary: Phosphatidylinositol 3-kinase phosphorylates the inositol ring of phosphatidylinositol at the 3-prime position. The enzyme comprises a 110 kD catalytic subunit and a regulatory subunit of either 85, 55, or 50 kD. This gene encodes the 85 kD regulatory subunit. Phosphatidylinositol 3-kinase plays an important role in the metabolic actions of insulin, and a mutation in this gene has been associated with insulin resistance. Alternative splicing of this gene results in four transcript variants encoding different isoforms. [provided by RefSeq, Jun 2011]
Mouse(18708) phosphatidylinositol 3-kinase, regulatory subunit, polypeptide 1 (p85 alpha)
Rat(25513) phosphoinositide-3-kinase, regulatory subunit 1 (alpha)
Zebrafish(557176) phosphoinositide-3-kinase, regulatory subunit 1 (p85 alpha)
chicken(427171) phosphoinositide-3-kinase, regulatory subunit 1 (alpha)
domestic cat(100271864) phosphoinositide-3-kinase, regulatory subunit 1 (alpha)
dog(487235) phosphoinositide-3-kinase, regulatory subunit 1 (alpha)
cow(282307) phosphoinositide-3-kinase, regulatory subunit 1 (alpha)
sheep(101121455) phosphoinositide-3-kinase, regulatory subunit 1 (alpha)
domestic guinea pig(100730242) phosphoinositide-3-kinase, regulatory subunit 1 (alpha)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4504315 Anti-phospho-PI3-kinase p85-α (pTyr607) antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, immunohistochemistry, western blot pricing
SAB4301553 Anti-phospho-PI3-kinase p85-α (pTyr607) antibody produced in rabbit affinity isolated antibody human, mouse
western blot pricing
SAB4504314 Anti-phospho-PI3-kinase p85-α/γ (pTyr467/199) antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, immunofluorescence, western blot pricing
SAB4300264 Anti-phospho-PIK3R1 (pTyr467) antibody produced in rabbit affinity isolated antibody human, mouse, rat
western blot pricing
SAB4502195 Anti-PI3-kinase p85-α antibody produced in rabbit affinity isolated antibody rat, human, mouse
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB4502196 Anti-PI3-kinase p85-α antibody produced in rabbit affinity isolated antibody rat, human, mouse
ELISA, immunofluorescence, immunohistochemistry pricing
SAB5500162 Anti-PI3K P85 antibody, Rabbit monoclonal recombinant, expressed in proprietary host, clone SP62, affinity isolated antibody human (tested)
flow cytometry, immunohistochemistry pricing
SAB1306396 ANTI-PI3KR1 (N-TERM L11) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
immunohistochemistry, western blot pricing
K3891 Anti-PIK3R1 (446-460) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
K4016 Anti-PIK3R1 (56-70) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
HPA001216 Anti-PIK3R1 antibody produced in rabbit Ab1, Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
SAB2106248 Anti-PIK3R1 antibody produced in rabbit affinity isolated antibody horse, rabbit, guinea pig, mouse, human
western blot pricing
SAB4300578 Anti-PIK3R1/PIK3R2/PIK3R3 (Ab-467/199/464) antibody produced in rabbit affinity isolated antibody rat, mouse, human
immunohistochemistry pricing
WH0005295M1 Monoclonal Anti-PIK3R1 antibody produced in mouse clone 3A10, purified immunoglobulin, buffered aqueous solution human, rat, mouse
ELISA, immunoprecipitation (IP), proximity ligation assay, western blot pricing
SAB1404206 Monoclonal Anti-PIK3R1 antibody produced in mouse clone 1C10, purified immunoglobulin, buffered aqueous solution mouse, human
ELISA, proximity ligation assay, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_181504 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_181504 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_181504 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001077495 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001077495 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001077495 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_011085 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011085 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011085 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-XM_043865 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_043865 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_043865 MISSION® shRNA Lentiviral Transduction Particles human pricing

Related Products

Product # Description Species Add to Cart
 
MABS76 Anti-PI3 kinase alpha Antibody, clone 2B12.1 This Anti-PI3 kinase alpha Antibody, clone 2B12.1 is validated for use in WB for the detection of PI3 kinase alpha. pricing
ABS1856 Anti-PI3 Kinase Antibody, p85 Detect PI 3-kinase alpha, p85 subunit using this rabbit polyclonal Anti-PI3 Kinase, p85, Cat. No. ABS1856 that has been tested in Immunoprecipitation and Western Blotting. pricing
ABS234 Anti-PI3 Kinase Antibody, p85 Detect PI3 Kinase, p85 using this rabbit polyclonal antibody, Anti-PI3 Kinase Antibody, p85 validated for use in western blotting & IP. pricing
MABS831 Anti-PI3 Kinase Antibody, p85 Antibody, N-SH3 Antibody, clone 1D5.1 Anti-PI3 Kinase, p85, N-SH3, clone 1D5.1, Cat. No. MABS831, is a mouse monoclonal antibody that detects human and murine p85 subunit of PI3 kinase. It has been tested for use in Western Blotting. pricing
05-217 Anti-PI3 Kinase Antibody, p85, N-SH2, Anti-PI3 Kinase Antibody, p85, N-SH2, is an antibody against PI3 Kinase for use in WB & IP. pricing
05-212 Anti-PI3 Kinase Antibody, p85, N-SH3, clone AB6 This Anti-PI3 Kinase Antibody, p85, N-SH3, clone AB6 is validated for use in IC, IP, WB for the detection of PI3 Kinase. pricing
16-107 Anti-PI3 Kinase Antibody, p85 Protein, agarose conjugate, 200 µg Anti-PI3 Kinase Antibody, p85, agarose conjugate detects level of PI3 Kinase & has been published & validated for use in IP. pricing
ABS233 Anti-PI3 Kinase p85 Antibody, N-SH2 domain Detect PI3 Kinase regulatory subunit alpha using this rabbit polyclonal Anti-PI3 Kinase p85, N-SH2 domain, Cat. No. ABS233, validated for use in Immunoprecipitation and Western Blotting. pricing
ABS233-AF488 Anti-PI3 Kinase p85 Antibody, N-SH2 domain Antibody, Alexa Fluor® 488 Conjugate Anti-PI3 Kinase p85, N-SH2 domain, Alexa Fluor® 488 Conjugate, Cat. No. ABS233-AF488, detects PI3 Kinase p85 and is validated for use in immunocytochemistry. pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_181504 Rosetta Predictions human pricing
NM_181523 Rosetta Predictions human pricing
NM_181524 Rosetta Predictions human pricing
NM_013005 Rosetta Predictions rat pricing
NM_001024955 Rosetta Predictions mouse pricing
NM_001077495 Rosetta Predictions mouse pricing
NM_011085 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181504 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00041447 predicted 814
2 SASI_Hs01_00041448 predicted 1062
3 SASI_Hs01_00041449 predicted 693
4 SASI_Hs01_00041450 predicted 919
5 SASI_Hs01_00041452 predicted 1298
6 SASI_Hs01_00041453 predicted 1380
7 SASI_Hs01_00041454 predicted 1241
8 SASI_Hs01_00041455 predicted 531
9 SASI_Hs01_00041456 predicted 431
10 SASI_Hs02_00370124 predicted 784
11 SASI_Hs01_00041451 predicted 1260
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181523 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00022804 predicted 1599
2 SASI_Hs01_00022805 predicted 1854
3 SASI_Hs01_00022806 predicted 1488
4 SASI_Hs01_00022807 predicted 1711
5 SASI_Hs01_00022808 predicted 2086
6 SASI_Hs01_00022809 predicted 2173
7 SASI_Hs01_00022810 predicted 2032
8 SASI_Hs01_00022811 predicted 1321
9 SASI_Hs01_00022812 predicted 1214
10 SASI_Hs01_00022813 predicted 1573
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181524 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00092757 predicted 974
2 SASI_Hs01_00092758 predicted 1224
3 SASI_Hs01_00092759 predicted 856
4 SASI_Hs01_00092760 predicted 1079
5 SASI_Hs01_00092762 predicted 1455
6 SASI_Hs01_00092763 predicted 1546
7 SASI_Hs01_00092764 predicted 1403
8 SASI_Hs01_00092765 predicted 693
9 SASI_Hs01_00092766 predicted 592
10 SASI_Hs02_00370144 predicted 941
11 SASI_Hs01_00092761 predicted 1419
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013005 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00096603 predicted 1921
2 SASI_Rn01_00096604 predicted 629
3 SASI_Rn01_00096605 predicted 1446
4 SASI_Rn01_00096606 predicted 588
5 SASI_Rn01_00096607 predicted 1900
6 SASI_Rn01_00096608 predicted 1414
7 SASI_Rn01_00096609 predicted 1442
8 SASI_Rn01_00096610 predicted 1302
9 SASI_Rn01_00096611 predicted 570
10 SASI_Rn01_00096612 predicted 1945
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024955 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00287760 predicted 922
2 SASI_Mm01_00128708 predicted 735
3 SASI_Mm01_00128709 predicted 1112
4 SASI_Mm01_00128710 predicted 1217
5 SASI_Mm02_00287761 predicted 1505
6 SASI_Mm01_00128713 predicted 992
7 SASI_Mm01_00128715 predicted 829
8 SASI_Mm02_00287762 predicted 1146
9 SASI_Mm01_00128717 predicted 1476
10 SASI_Mm02_00287763 predicted 1538
11 SASI_Mm01_00128711 predicted 734
12 SASI_Mm01_00128712 predicted 1009
13 SASI_Mm01_00128714 predicted 1010
14 SASI_Mm01_00128716 predicted 1120
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001077495 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00292682 predicted 2000
2 SASI_Mm02_00292683 predicted 1811
3 SASI_Mm02_00292684 predicted 2188
4 SASI_Mm02_00292685 predicted 2289
5 SASI_Mm02_00292686 predicted 2581
6 SASI_Mm02_00292687 predicted 2068
7 SASI_Mm02_00292688 predicted 1899
8 SASI_Mm02_00292689 predicted 2220
9 SASI_Mm02_00292690 predicted 2548
10 SASI_Mm02_00292691 predicted 2609
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011085 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00199246 predicted 746
2 SASI_Mm01_00199247 predicted 1120
3 SASI_Mm01_00199248 predicted 1217
4 SASI_Mm01_00199249 predicted 740
5 SASI_Mm01_00199250 predicted 1007
6 SASI_Mm01_00199251 predicted 1000
7 SASI_Mm01_00199252 predicted 1002
8 SASI_Mm01_00199253 predicted 835
9 SASI_Mm01_00199254 predicted 1117
10 SASI_Mm01_00199255 predicted 1481
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_181504
VALIDATED
PIK3R1 MISSION shRNA Bacterial Glycerol Stock
phosphoinositide-3-kinase, regulatory subunit 1 (alpha)
Human
17 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000432098    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181504.2-908s21c1
Sequence:CCGGGGCAGCTGAGTATCGAGAAATCTCGAGATTTCTCGATACTCAGCTGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430557    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181504.2-1752s21c1
Sequence:CCGGTAACCATGGTGCTTGTTAATGCTCGAGCATTAACAAGCACCATGGTTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430938    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181504.2-523s21c1
Sequence:CCGGTACTTTATCCAGTATCCAAATCTCGAGATTTGGATACTGGATAAAGTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416842    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181504.2-1235s21c1
Sequence:CCGGAGTGGTGGACGGCGAAGTAAACTCGAGTTTACTTCGCCGTCCACCACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413458    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181504.2-630s21c1
Sequence:CCGGAGTCGAGAATATGATAGATTACTCGAGTAATCTATCATATTCTCGACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413602    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181504.2-403s21c1
Sequence:CCGGTTCATCGAGATGGGAAATATGCTCGAGCATATTTCCCATCTCGATGAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417698    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181504.2-1906s21c1
Sequence:CCGGACATCGCACTGTGGATTATTTCTCGAGAAATAATCCACAGTGCGATGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200002    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_181504.2-1297s1c1
Sequence:CCGGCCGAGCCCTATAACTTGTACACTCGAGTGTACAAGTTATAGGGCTCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196285    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181504.2-344s1c1
Sequence:CCGGGCATGGTGATTATACTCTTACCTCGAGGTAAGAGTATAATCACCATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199461    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_181504.2-4226s1c1
Sequence:CCGGGCAGAGGCACTCCTGATATATCTCGAGATATATCAGGAGTGCCTCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196697    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181504.2-102s1c1
Sequence:CCGGGAATATGCCAAGACAGATATACTCGAGTATATCTGTCTTGGCATATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199643    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_181504.2-3664s1c1
Sequence:CCGGGCCCTCAAACTTGACTCTACTCTCGAGAGTAGAGTCAAGTTTGAGGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033288    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_181504.2-758s1c1
Sequence:CCGGGCGGTACAGCAAAGAATACATCTCGAGATGTATTCTTTGCTGTACCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033287    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181504.2-1379s1c1
Sequence:CCGGCCTCAATGTCACACTAGCCTACTCGAGTAGGCTAGTGTGACATTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033286    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181504.2-92s1c1
Sequence:CCGGCCTGGATTTAGAATATGCCAACTCGAGTTGGCATATTCTAAATCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033285    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181504.2-1102s1c1
Sequence:CCGGCCCATCATGATGAGAAGACATCTCGAGATGTCTTCTCATCATGATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033284    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_181504.2-442s1c1
Sequence:CCGGCCTTCAGTTCTGTGGTTGAATCTCGAGATTCAACCACAGAACTGAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_181504
VALIDATED
PIK3R1 MISSION shRNA shRNA Plasmid DNA
phosphoinositide-3-kinase, regulatory subunit 1 (alpha)
Human
17 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000432098    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181504.2-908s21c1
Sequence:CCGGGGCAGCTGAGTATCGAGAAATCTCGAGATTTCTCGATACTCAGCTGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430557    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181504.2-1752s21c1
Sequence:CCGGTAACCATGGTGCTTGTTAATGCTCGAGCATTAACAAGCACCATGGTTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430938    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181504.2-523s21c1
Sequence:CCGGTACTTTATCCAGTATCCAAATCTCGAGATTTGGATACTGGATAAAGTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416842    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181504.2-1235s21c1
Sequence:CCGGAGTGGTGGACGGCGAAGTAAACTCGAGTTTACTTCGCCGTCCACCACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413458    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181504.2-630s21c1
Sequence:CCGGAGTCGAGAATATGATAGATTACTCGAGTAATCTATCATATTCTCGACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413602    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181504.2-403s21c1
Sequence:CCGGTTCATCGAGATGGGAAATATGCTCGAGCATATTTCCCATCTCGATGAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417698    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181504.2-1906s21c1
Sequence:CCGGACATCGCACTGTGGATTATTTCTCGAGAAATAATCCACAGTGCGATGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000200002    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_181504.2-1297s1c1
Sequence:CCGGCCGAGCCCTATAACTTGTACACTCGAGTGTACAAGTTATAGGGCTCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196285    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181504.2-344s1c1
Sequence:CCGGGCATGGTGATTATACTCTTACCTCGAGGTAAGAGTATAATCACCATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199461    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_181504.2-4226s1c1
Sequence:CCGGGCAGAGGCACTCCTGATATATCTCGAGATATATCAGGAGTGCCTCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196697    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181504.2-102s1c1
Sequence:CCGGGAATATGCCAAGACAGATATACTCGAGTATATCTGTCTTGGCATATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199643    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_181504.2-3664s1c1
Sequence:CCGGGCCCTCAAACTTGACTCTACTCTCGAGAGTAGAGTCAAGTTTGAGGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033288    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_181504.2-758s1c1
Sequence:CCGGGCGGTACAGCAAAGAATACATCTCGAGATGTATTCTTTGCTGTACCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033287    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181504.2-1379s1c1
Sequence:CCGGCCTCAATGTCACACTAGCCTACTCGAGTAGGCTAGTGTGACATTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033286    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181504.2-92s1c1
Sequence:CCGGCCTGGATTTAGAATATGCCAACTCGAGTTGGCATATTCTAAATCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033285    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181504.2-1102s1c1
Sequence:CCGGCCCATCATGATGAGAAGACATCTCGAGATGTCTTCTCATCATGATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033284    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_181504.2-442s1c1
Sequence:CCGGCCTTCAGTTCTGTGGTTGAATCTCGAGATTCAACCACAGAACTGAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_181504
VALIDATED
PIK3R1 MISSION shRNA Lentiviral Transduction Particles
phosphoinositide-3-kinase, regulatory subunit 1 (alpha)
Human
17 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000432098    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181504.2-908s21c1
Sequence:CCGGGGCAGCTGAGTATCGAGAAATCTCGAGATTTCTCGATACTCAGCTGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430557    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181504.2-1752s21c1
Sequence:CCGGTAACCATGGTGCTTGTTAATGCTCGAGCATTAACAAGCACCATGGTTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430938    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181504.2-523s21c1
Sequence:CCGGTACTTTATCCAGTATCCAAATCTCGAGATTTGGATACTGGATAAAGTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416842    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181504.2-1235s21c1
Sequence:CCGGAGTGGTGGACGGCGAAGTAAACTCGAGTTTACTTCGCCGTCCACCACTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413458    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181504.2-630s21c1
Sequence:CCGGAGTCGAGAATATGATAGATTACTCGAGTAATCTATCATATTCTCGACTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413602    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181504.2-403s21c1
Sequence:CCGGTTCATCGAGATGGGAAATATGCTCGAGCATATTTCCCATCTCGATGAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417698    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181504.2-1906s21c1
Sequence:CCGGACATCGCACTGTGGATTATTTCTCGAGAAATAATCCACAGTGCGATGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200002    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_181504.2-1297s1c1
Sequence:CCGGCCGAGCCCTATAACTTGTACACTCGAGTGTACAAGTTATAGGGCTCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196285    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181504.2-344s1c1
Sequence:CCGGGCATGGTGATTATACTCTTACCTCGAGGTAAGAGTATAATCACCATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199461    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_181504.2-4226s1c1
Sequence:CCGGGCAGAGGCACTCCTGATATATCTCGAGATATATCAGGAGTGCCTCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196697    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181504.2-102s1c1
Sequence:CCGGGAATATGCCAAGACAGATATACTCGAGTATATCTGTCTTGGCATATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199643    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_181504.2-3664s1c1
Sequence:CCGGGCCCTCAAACTTGACTCTACTCTCGAGAGTAGAGTCAAGTTTGAGGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033288    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_181504.2-758s1c1
Sequence:CCGGGCGGTACAGCAAAGAATACATCTCGAGATGTATTCTTTGCTGTACCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033287    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181504.2-1379s1c1
Sequence:CCGGCCTCAATGTCACACTAGCCTACTCGAGTAGGCTAGTGTGACATTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033286    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181504.2-92s1c1
Sequence:CCGGCCTGGATTTAGAATATGCCAACTCGAGTTGGCATATTCTAAATCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033285    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181504.2-1102s1c1
Sequence:CCGGCCCATCATGATGAGAAGACATCTCGAGATGTCTTCTCATCATGATGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033284    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_181504.2-442s1c1
Sequence:CCGGCCTTCAGTTCTGTGGTTGAATCTCGAGATTCAACCACAGAACTGAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001077495
VALIDATED
PIK3R1 MISSION shRNA Bacterial Glycerol Stock
phosphoinositide-3-kinase, regulatory subunit 1 (alpha)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000302323    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001077495.1-2508s21c1
Sequence:CCGGCAACCGAAACAAAGCGGAGAACTCGAGTTCTCCGCTTTGTTTCGGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302387    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001077495.1-1716s21c1
Sequence:CCGGCGGCGATTACACTCTTACACTCTCGAGAGTGTAAGAGTGTAATCGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304742    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001077495.1-2619s21c1
Sequence:CCGGAGTCAAGCATTGCGTCATTAACTCGAGTTAATGACGCAATGCTTGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304741    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001077495.1-1690s21c1
Sequence:CCGGGTACGAGACGCATCTACTAAACTCGAGTTTAGTAGATGCGTCTCGTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304740    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001077495.1-2984s21c1
Sequence:CCGGCCAGACGTTTCTAACCTTATCCTCGAGGATAAGGTTAGAAACGTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001077495
VALIDATED
PIK3R1 MISSION shRNA shRNA Plasmid DNA
phosphoinositide-3-kinase, regulatory subunit 1 (alpha)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000302323    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001077495.1-2508s21c1
Sequence:CCGGCAACCGAAACAAAGCGGAGAACTCGAGTTCTCCGCTTTGTTTCGGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000302387    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001077495.1-1716s21c1
Sequence:CCGGCGGCGATTACACTCTTACACTCTCGAGAGTGTAAGAGTGTAATCGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000304742    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001077495.1-2619s21c1
Sequence:CCGGAGTCAAGCATTGCGTCATTAACTCGAGTTAATGACGCAATGCTTGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000304741    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001077495.1-1690s21c1
Sequence:CCGGGTACGAGACGCATCTACTAAACTCGAGTTTAGTAGATGCGTCTCGTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000304740    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001077495.1-2984s21c1
Sequence:CCGGCCAGACGTTTCTAACCTTATCCTCGAGGATAAGGTTAGAAACGTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001077495
VALIDATED
PIK3R1 MISSION shRNA Lentiviral Transduction Particles
phosphoinositide-3-kinase, regulatory subunit 1 (alpha)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000302323    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001077495.1-2508s21c1
Sequence:CCGGCAACCGAAACAAAGCGGAGAACTCGAGTTCTCCGCTTTGTTTCGGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302387    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001077495.1-1716s21c1
Sequence:CCGGCGGCGATTACACTCTTACACTCTCGAGAGTGTAAGAGTGTAATCGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304742    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001077495.1-2619s21c1
Sequence:CCGGAGTCAAGCATTGCGTCATTAACTCGAGTTAATGACGCAATGCTTGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304741    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001077495.1-1690s21c1
Sequence:CCGGGTACGAGACGCATCTACTAAACTCGAGTTTAGTAGATGCGTCTCGTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304740    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001077495.1-2984s21c1
Sequence:CCGGCCAGACGTTTCTAACCTTATCCTCGAGGATAAGGTTAGAAACGTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011085
VALIDATED
PIK3R1 MISSION shRNA Bacterial Glycerol Stock
phosphoinositide-3-kinase, regulatory subunit 1 (alpha)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000068193    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011085.1-684s1c1
Sequence:CCGGCGAAGCATTTAATGAAACCATCTCGAGATGGTTTCATTAAATGCTTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068196    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011085.1-1119s1c1
Sequence:CCGGCAACCGAAACAAAGCGGAGAACTCGAGTTCTCCGCTTTGTTTCGGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068197    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011085.1-327s1c1
Sequence:CCGGCGGCGATTACACTCTTACACTCTCGAGAGTGTAAGAGTGTAATCGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068195    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011085.1-611s1c1
Sequence:CCGGGTCGGGAATATGATAGATTATCTCGAGATAATCTATCATATTCCCGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068194    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011085.1-1359s1c1
Sequence:CCGGCCTCAATGTCACACTAGCATACTCGAGTATGCTAGTGTGACATTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011085
VALIDATED
PIK3R1 MISSION shRNA shRNA Plasmid DNA
phosphoinositide-3-kinase, regulatory subunit 1 (alpha)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000068193    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011085.1-684s1c1
Sequence:CCGGCGAAGCATTTAATGAAACCATCTCGAGATGGTTTCATTAAATGCTTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068196    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011085.1-1119s1c1
Sequence:CCGGCAACCGAAACAAAGCGGAGAACTCGAGTTCTCCGCTTTGTTTCGGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068197    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011085.1-327s1c1
Sequence:CCGGCGGCGATTACACTCTTACACTCTCGAGAGTGTAAGAGTGTAATCGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068195    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011085.1-611s1c1
Sequence:CCGGGTCGGGAATATGATAGATTATCTCGAGATAATCTATCATATTCCCGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068194    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011085.1-1359s1c1
Sequence:CCGGCCTCAATGTCACACTAGCATACTCGAGTATGCTAGTGTGACATTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011085
VALIDATED
PIK3R1 MISSION shRNA Lentiviral Transduction Particles
phosphoinositide-3-kinase, regulatory subunit 1 (alpha)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000068193    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011085.1-684s1c1
Sequence:CCGGCGAAGCATTTAATGAAACCATCTCGAGATGGTTTCATTAAATGCTTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068196    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011085.1-1119s1c1
Sequence:CCGGCAACCGAAACAAAGCGGAGAACTCGAGTTCTCCGCTTTGTTTCGGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068197    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011085.1-327s1c1
Sequence:CCGGCGGCGATTACACTCTTACACTCTCGAGAGTGTAAGAGTGTAATCGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068195    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011085.1-611s1c1
Sequence:CCGGGTCGGGAATATGATAGATTATCTCGAGATAATCTATCATATTCCCGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068194    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011085.1-1359s1c1
Sequence:CCGGCCTCAATGTCACACTAGCATACTCGAGTATGCTAGTGTGACATTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_043865
VALIDATED
PIK3R1 MISSION shRNA Bacterial Glycerol Stock
phosphoinositide-3-kinase, regulatory subunit 1 (alpha)
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000039904    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 1 Clone ID:XM_043865.4-1058s1c1
Sequence:CCGGCGAGGGAAGAAGTGAATGAAACTCGAGTTTCATTCACTTCTTCCCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039905    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_043865.4-190s1c1
Sequence:CCGGCCTGAAGAAATTGGCTGGTTACTCGAGTAACCAGCCAATTTCTTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039907    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCH58
TRC Version: 1 Clone ID:XM_043865.4-644s1c1
Sequence:CCGGCCGTTTACAGTGAAATGATTTCTCGAGAAATCATTTCACTGTAAACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039906    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 1 Clone ID:XM_043865.4-1549s1c1
Sequence:CCGGCGGTACAGCAAAGAATACATACTCGAGTATGTATTCTTTGCTGTACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_043865
VALIDATED
PIK3R1 MISSION shRNA shRNA Plasmid DNA
phosphoinositide-3-kinase, regulatory subunit 1 (alpha)
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000039904    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 1 Clone ID:XM_043865.4-1058s1c1
Sequence:CCGGCGAGGGAAGAAGTGAATGAAACTCGAGTTTCATTCACTTCTTCCCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039905    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_043865.4-190s1c1
Sequence:CCGGCCTGAAGAAATTGGCTGGTTACTCGAGTAACCAGCCAATTTCTTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039907    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCH58
TRC Version: 1 Clone ID:XM_043865.4-644s1c1
Sequence:CCGGCCGTTTACAGTGAAATGATTTCTCGAGAAATCATTTCACTGTAAACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039906    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 1 Clone ID:XM_043865.4-1549s1c1
Sequence:CCGGCGGTACAGCAAAGAATACATACTCGAGTATGTATTCTTTGCTGTACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_043865
VALIDATED
PIK3R1 MISSION shRNA Lentiviral Transduction Particles
phosphoinositide-3-kinase, regulatory subunit 1 (alpha)
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000039904    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 1 Clone ID:XM_043865.4-1058s1c1
Sequence:CCGGCGAGGGAAGAAGTGAATGAAACTCGAGTTTCATTCACTTCTTCCCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039905    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_043865.4-190s1c1
Sequence:CCGGCCTGAAGAAATTGGCTGGTTACTCGAGTAACCAGCCAATTTCTTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039907    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCH58
TRC Version: 1 Clone ID:XM_043865.4-644s1c1
Sequence:CCGGCCGTTTACAGTGAAATGATTTCTCGAGAAATCATTTCACTGTAAACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039906    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 1 Clone ID:XM_043865.4-1549s1c1
Sequence:CCGGCGGTACAGCAAAGAATACATACTCGAGTATGTATTCTTTGCTGTACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)