EMAIL THIS PAGE TO A FRIEND

PIK3R2

phosphoinositide-3-kinase, regulatory subunit 2 (beta)

62 Gene Product Result for
Synonyms: MPPH P85B p85 p85-BETA
UniProtKB ID: O00459, Q5EAT5, Q9UPH9
Gene ID:
Human(5296) Summary: Phosphatidylinositol 3-kinase (PI3K) is a lipid kinase that phosphorylates phosphatidylinositol and similar compounds, creating second messengers important in growth signaling pathways. PI3K functions as a heterodimer of a regulatory and a catalytic subunit. The protein encoded by this gene is a regulatory component of PI3K. Two transcript variants, one protein coding and the other non-protein coding, have been found for this gene. [provided by RefSeq, Dec 2012]
Mouse(18709) phosphatidylinositol 3-kinase, regulatory subunit, polypeptide 2 (p85 beta)
Rat(29741) phosphoinositide-3-kinase, regulatory subunit 2 (beta)
domestic guinea pig(100734044) phosphoinositide-3-kinase, regulatory subunit 2 (beta)
naked mole-rat(101718815) phosphoinositide-3-kinase, regulatory subunit 2 (beta)
cow(282308) phosphoinositide-3-kinase, regulatory subunit 2 (beta)
sheep(101111546) phosphoinositide-3-kinase, regulatory subunit 2 (beta)
Zebrafish(404211) phosphoinositide-3-kinase, regulatory subunit, polypeptide 2
domestic cat(101093586) phosphoinositide-3-kinase, regulatory subunit 2 (beta)
dog(609956) phosphoinositide-3-kinase, regulatory subunit 2 (beta)
chicken(771142) phosphoinositide-3-kinase, regulatory subunit 2 (beta)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005027 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005027 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005027 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008841 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008841 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008841 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005027 Rosetta Predictions human pricing
NM_022185 Rosetta Predictions rat pricing
NM_008841 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005027 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00183622 predicted 1628
2 SASI_Hs01_00183623 predicted 1966
3 SASI_Hs02_00338808 predicted 1599
4 SASI_Hs01_00183624 predicted 2101
5 SASI_Hs01_00183625 predicted 2240
6 SASI_Hs01_00183627 predicted 2307
7 SASI_Hs01_00183629 predicted 1701
8 SASI_Hs01_00183630 predicted 2192
9 SASI_Hs02_00338809 predicted 1926
10 SASI_Hs02_00338810 predicted 1868
11 SASI_Hs01_00183626 predicted 1622
12 SASI_Hs01_00183628 predicted 1774
13 SASI_Hs01_00183631 predicted 1948
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022185 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00118354 predicted 1887
2 SASI_Rn01_00118355 predicted 1534
3 SASI_Rn01_00118356 predicted 1876
4 SASI_Rn01_00118357 predicted 1633
5 SASI_Rn01_00118358 predicted 1018
6 SASI_Rn01_00118359 predicted 2078
7 SASI_Rn01_00118360 predicted 2508
8 SASI_Rn01_00118361 predicted 2004
9 SASI_Rn01_00118362 predicted 1497
10 SASI_Rn01_00118363 predicted 1957
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008841 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00117069 predicted 1541
2 SASI_Mm01_00117071 predicted 1805
3 SASI_Mm01_00117072 predicted 1854
4 SASI_Mm01_00117073 predicted 1542
5 SASI_Mm01_00117074 predicted 1803
6 SASI_Mm01_00117075 predicted 1652
7 SASI_Mm01_00117076 predicted 599
8 SASI_Mm01_00117077 predicted 2091
9 SASI_Mm01_00117078 predicted 950
10 SASI_Mm02_00314780 predicted 2527
11 SASI_Mm01_00117070 predicted 1887
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005027
VALIDATED
PIK3R2 MISSION shRNA Bacterial Glycerol Stock
phosphoinositide-3-kinase, regulatory subunit 2 (beta)
Human
17 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000010402    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005027.x-1786s1c1
Sequence:CCGGAAAGAGATGCAAAGGATCCTCTCGAGAGGATCCTTTGCATCTCTTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039687    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005027.2-2054s1c1
Sequence:CCGGCGAGAAAGAGATGCAAAGGATCTCGAGATCCTTTGCATCTCTTTCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039683    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005027.2-3751s1c1
Sequence:CCGGCTCTTCGATCATGTTGGGTTTCTCGAGAAACCCAACATGATCGAAGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295907    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005027.2-2958s21c1
Sequence:CCGGCTACGTGTCCTCCGGGCATTGCTCGAGCAATGCCCGGAGGACACGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039685    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005027.2-1574s1c1
Sequence:CCGGCCGAGATGCTTCTAGCAAGATCTCGAGATCTTGCTAGAAGCATCTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197119    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005027.2-2166s1c1
Sequence:CCGGGACAACAGAGAGATCGACAAGCTCGAGCTTGTCGATCTCTCTGTTGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039684    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005027.2-1884s1c1
Sequence:CCGGCGCGAGTATGACCAGCTTTATCTCGAGATAAAGCTGGTCATACTCGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018339    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005027.x-1664s1c1
Sequence:CCGGCAGATGAAGCGTACTGCAATTCTCGAGAATTGCAGTACGCTTCATCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197267    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005027.2-1373s1c1
Sequence:CCGGGCTTCAGGAACACTTGGAAGACTCGAGTCTTCCAAGTGTTCCTGAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199521    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005027.2-2797s1c1
Sequence:CCGGGTCCTCATTTCTCCGGCTCTGCTCGAGCAGAGCCGGAGAAATGAGGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199567    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005027.2-2607s1c1
Sequence:CCGGGCCTCGCTGGTGCAGCACAACCTCGAGGTTGTGCTGCACCAGCGAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199696    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005027.2-2958s1c1
Sequence:CCGGCTACGTGTCCTCCGGGCATTGCTCGAGCAATGCCCGGAGGACACGTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199802    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005027.2-2090s1c1
Sequence:CCGGGCGGCTCAAGTCCCGCATTGCCTCGAGGCAATGCGGGACTTGAGCCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199919    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005027.2-1840s1c1
Sequence:CCGGGCGCCCAGCTTAAGGTCTATCCTCGAGGATAGACCTTAAGCTGGGCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288633    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005027.2-1934s21c1
Sequence:CCGGGCAGATGAAGCGTACTGCAATCTCGAGATTGCAGTACGCTTCATCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306978    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005027.2-1574s21c1
Sequence:CCGGCCGAGATGCTTCTAGCAAGATCTCGAGATCTTGCTAGAAGCATCTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000307984    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005027.2-2057s21c1
Sequence:CCGGGAAAGAGATGCAAAGGATCCTCTCGAGAGGATCCTTTGCATCTCTTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005027
VALIDATED
PIK3R2 MISSION shRNA shRNA Plasmid DNA
phosphoinositide-3-kinase, regulatory subunit 2 (beta)
Human
17 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000010402    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005027.x-1786s1c1
Sequence:CCGGAAAGAGATGCAAAGGATCCTCTCGAGAGGATCCTTTGCATCTCTTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039687    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005027.2-2054s1c1
Sequence:CCGGCGAGAAAGAGATGCAAAGGATCTCGAGATCCTTTGCATCTCTTTCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039683    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005027.2-3751s1c1
Sequence:CCGGCTCTTCGATCATGTTGGGTTTCTCGAGAAACCCAACATGATCGAAGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000295907    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005027.2-2958s21c1
Sequence:CCGGCTACGTGTCCTCCGGGCATTGCTCGAGCAATGCCCGGAGGACACGTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039685    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005027.2-1574s1c1
Sequence:CCGGCCGAGATGCTTCTAGCAAGATCTCGAGATCTTGCTAGAAGCATCTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000197119    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005027.2-2166s1c1
Sequence:CCGGGACAACAGAGAGATCGACAAGCTCGAGCTTGTCGATCTCTCTGTTGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039684    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005027.2-1884s1c1
Sequence:CCGGCGCGAGTATGACCAGCTTTATCTCGAGATAAAGCTGGTCATACTCGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018339    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005027.x-1664s1c1
Sequence:CCGGCAGATGAAGCGTACTGCAATTCTCGAGAATTGCAGTACGCTTCATCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000197267    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005027.2-1373s1c1
Sequence:CCGGGCTTCAGGAACACTTGGAAGACTCGAGTCTTCCAAGTGTTCCTGAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199521    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005027.2-2797s1c1
Sequence:CCGGGTCCTCATTTCTCCGGCTCTGCTCGAGCAGAGCCGGAGAAATGAGGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199567    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005027.2-2607s1c1
Sequence:CCGGGCCTCGCTGGTGCAGCACAACCTCGAGGTTGTGCTGCACCAGCGAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199696    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005027.2-2958s1c1
Sequence:CCGGCTACGTGTCCTCCGGGCATTGCTCGAGCAATGCCCGGAGGACACGTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199802    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005027.2-2090s1c1
Sequence:CCGGGCGGCTCAAGTCCCGCATTGCCTCGAGGCAATGCGGGACTTGAGCCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199919    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005027.2-1840s1c1
Sequence:CCGGGCGCCCAGCTTAAGGTCTATCCTCGAGGATAGACCTTAAGCTGGGCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000288633    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005027.2-1934s21c1
Sequence:CCGGGCAGATGAAGCGTACTGCAATCTCGAGATTGCAGTACGCTTCATCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000306978    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005027.2-1574s21c1
Sequence:CCGGCCGAGATGCTTCTAGCAAGATCTCGAGATCTTGCTAGAAGCATCTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000307984    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005027.2-2057s21c1
Sequence:CCGGGAAAGAGATGCAAAGGATCCTCTCGAGAGGATCCTTTGCATCTCTTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005027
VALIDATED
PIK3R2 MISSION shRNA Lentiviral Transduction Particles
phosphoinositide-3-kinase, regulatory subunit 2 (beta)
Human
17 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000010402    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005027.x-1786s1c1
Sequence:CCGGAAAGAGATGCAAAGGATCCTCTCGAGAGGATCCTTTGCATCTCTTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039687    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005027.2-2054s1c1
Sequence:CCGGCGAGAAAGAGATGCAAAGGATCTCGAGATCCTTTGCATCTCTTTCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039683    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005027.2-3751s1c1
Sequence:CCGGCTCTTCGATCATGTTGGGTTTCTCGAGAAACCCAACATGATCGAAGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295907    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005027.2-2958s21c1
Sequence:CCGGCTACGTGTCCTCCGGGCATTGCTCGAGCAATGCCCGGAGGACACGTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039685    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005027.2-1574s1c1
Sequence:CCGGCCGAGATGCTTCTAGCAAGATCTCGAGATCTTGCTAGAAGCATCTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197119    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005027.2-2166s1c1
Sequence:CCGGGACAACAGAGAGATCGACAAGCTCGAGCTTGTCGATCTCTCTGTTGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039684    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005027.2-1884s1c1
Sequence:CCGGCGCGAGTATGACCAGCTTTATCTCGAGATAAAGCTGGTCATACTCGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018339    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005027.x-1664s1c1
Sequence:CCGGCAGATGAAGCGTACTGCAATTCTCGAGAATTGCAGTACGCTTCATCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197267    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005027.2-1373s1c1
Sequence:CCGGGCTTCAGGAACACTTGGAAGACTCGAGTCTTCCAAGTGTTCCTGAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199521    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005027.2-2797s1c1
Sequence:CCGGGTCCTCATTTCTCCGGCTCTGCTCGAGCAGAGCCGGAGAAATGAGGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199567    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005027.2-2607s1c1
Sequence:CCGGGCCTCGCTGGTGCAGCACAACCTCGAGGTTGTGCTGCACCAGCGAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199696    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005027.2-2958s1c1
Sequence:CCGGCTACGTGTCCTCCGGGCATTGCTCGAGCAATGCCCGGAGGACACGTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199802    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005027.2-2090s1c1
Sequence:CCGGGCGGCTCAAGTCCCGCATTGCCTCGAGGCAATGCGGGACTTGAGCCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199919    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005027.2-1840s1c1
Sequence:CCGGGCGCCCAGCTTAAGGTCTATCCTCGAGGATAGACCTTAAGCTGGGCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288633    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005027.2-1934s21c1
Sequence:CCGGGCAGATGAAGCGTACTGCAATCTCGAGATTGCAGTACGCTTCATCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306978    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005027.2-1574s21c1
Sequence:CCGGCCGAGATGCTTCTAGCAAGATCTCGAGATCTTGCTAGAAGCATCTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000307984    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005027.2-2057s21c1
Sequence:CCGGGAAAGAGATGCAAAGGATCCTCTCGAGAGGATCCTTTGCATCTCTTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008841
VALIDATED
PIK3R2 MISSION shRNA Bacterial Glycerol Stock
phosphoinositide-3-kinase, regulatory subunit 2 (beta)
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000361418    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008841.2-2260s21c1
Sequence:CCGGCGAGACTGAGGACCAGTATTCCTCGAGGAATACTGGTCCTCAGTCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025085    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008841.1-1702s1c1
Sequence:CCGGCCTGTGTCCAAGTACCAACAACTCGAGTTGTTGGTACTTGGACACAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025086    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008841.1-2191s1c1
Sequence:CCGGCGACAGAGGAAGATCAACGAACTCGAGTTCGTTGATCTTCCTCTGTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361416    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008841.2-1823s21c1
Sequence:CCGGCAGGACAAGAGCCGCGAATATCTCGAGATATTCGCGGCTCTTGTCCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361419    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008841.2-1367s21c1
Sequence:CCGGCTACCACCTAAGCCCTCTAAGCTCGAGCTTAGAGGGCTTAGGTGGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025087    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008841.1-1548s1c1
Sequence:CCGGCGGGAACAACAAGTTGATCAACTCGAGTTGATCAACTTGTTGTTCCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025088    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008841.1-952s1c1
Sequence:CCGGACCGCCTTGTATGATGCTGTTCTCGAGAACAGCATCATACAAGGCGGTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361417    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008841.2-1960s21c1
Sequence:CCGGGAAATGCAGCAAGGAGTATTTCTCGAGAAATACTCCTTGCTGCATTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361350    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008841.2-985s21c1
Sequence:CCGGCGCCTTGTATGATGCTGTTAACTCGAGTTAACAGCATCATACAAGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008841
VALIDATED
PIK3R2 MISSION shRNA shRNA Plasmid DNA
phosphoinositide-3-kinase, regulatory subunit 2 (beta)
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000361418    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008841.2-2260s21c1
Sequence:CCGGCGAGACTGAGGACCAGTATTCCTCGAGGAATACTGGTCCTCAGTCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025085    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008841.1-1702s1c1
Sequence:CCGGCCTGTGTCCAAGTACCAACAACTCGAGTTGTTGGTACTTGGACACAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025086    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008841.1-2191s1c1
Sequence:CCGGCGACAGAGGAAGATCAACGAACTCGAGTTCGTTGATCTTCCTCTGTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000361416    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008841.2-1823s21c1
Sequence:CCGGCAGGACAAGAGCCGCGAATATCTCGAGATATTCGCGGCTCTTGTCCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000361419    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008841.2-1367s21c1
Sequence:CCGGCTACCACCTAAGCCCTCTAAGCTCGAGCTTAGAGGGCTTAGGTGGTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025087    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008841.1-1548s1c1
Sequence:CCGGCGGGAACAACAAGTTGATCAACTCGAGTTGATCAACTTGTTGTTCCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025088    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008841.1-952s1c1
Sequence:CCGGACCGCCTTGTATGATGCTGTTCTCGAGAACAGCATCATACAAGGCGGTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000361417    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008841.2-1960s21c1
Sequence:CCGGGAAATGCAGCAAGGAGTATTTCTCGAGAAATACTCCTTGCTGCATTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000361350    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008841.2-985s21c1
Sequence:CCGGCGCCTTGTATGATGCTGTTAACTCGAGTTAACAGCATCATACAAGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008841
VALIDATED
PIK3R2 MISSION shRNA Lentiviral Transduction Particles
phosphoinositide-3-kinase, regulatory subunit 2 (beta)
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000361418    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008841.2-2260s21c1
Sequence:CCGGCGAGACTGAGGACCAGTATTCCTCGAGGAATACTGGTCCTCAGTCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025085    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008841.1-1702s1c1
Sequence:CCGGCCTGTGTCCAAGTACCAACAACTCGAGTTGTTGGTACTTGGACACAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025086    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008841.1-2191s1c1
Sequence:CCGGCGACAGAGGAAGATCAACGAACTCGAGTTCGTTGATCTTCCTCTGTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361416    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008841.2-1823s21c1
Sequence:CCGGCAGGACAAGAGCCGCGAATATCTCGAGATATTCGCGGCTCTTGTCCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361419    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008841.2-1367s21c1
Sequence:CCGGCTACCACCTAAGCCCTCTAAGCTCGAGCTTAGAGGGCTTAGGTGGTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025087    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008841.1-1548s1c1
Sequence:CCGGCGGGAACAACAAGTTGATCAACTCGAGTTGATCAACTTGTTGTTCCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025088    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008841.1-952s1c1
Sequence:CCGGACCGCCTTGTATGATGCTGTTCTCGAGAACAGCATCATACAAGGCGGTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361417    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008841.2-1960s21c1
Sequence:CCGGGAAATGCAGCAAGGAGTATTTCTCGAGAAATACTCCTTGCTGCATTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361350    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008841.2-985s21c1
Sequence:CCGGCGCCTTGTATGATGCTGTTAACTCGAGTTAACAGCATCATACAAGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)