EMAIL THIS PAGE TO A FRIEND

PIK3R3

phosphoinositide-3-kinase, regulatory subunit 3 (gamma)

190 Gene Product Result for
Synonyms: p55 p55-GAMMA
UniProtKB ID: Q92569, B2R9C1, D3DQ12, O60482, Q5T4P1, Q5T4P2
Gene ID:
Mouse(18710) phosphatidylinositol 3 kinase, regulatory subunit, polypeptide 3 (p55)
Rat(60664) phosphoinositide-3-kinase, regulatory subunit 3 (gamma)
chicken(429096) phosphoinositide-3-kinase, regulatory subunit 3 (gamma)
dog(482512) phosphoinositide-3-kinase, regulatory subunit 3 (gamma)
domestic cat(101093286) phosphoinositide-3-kinase, regulatory subunit 3 (gamma)
cow(286865) phosphoinositide-3-kinase, regulatory subunit 3 (gamma)
sheep(101123247) phosphoinositide-3-kinase, regulatory subunit 3 (gamma)
naked mole-rat(101717096) phosphoinositide-3-kinase, regulatory subunit 3 (gamma)
domestic guinea pig(100734206) phosphoinositide-3-kinase, regulatory subunit 3 (gamma)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_181585 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_181585 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_181585 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003629 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003629 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003629 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001114172 Rosetta Predictions human pricing
NM_003629 Rosetta Predictions human pricing
NM_022213 Rosetta Predictions rat pricing
NM_181585 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001114172 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00326414 predicted 662
2 SASI_Hs02_00326415 predicted 834
3 SASI_Hs02_00326416 predicted 1186
4 SASI_Hs02_00326417 predicted 716
5 SASI_Hs02_00326418 predicted 850
6 SASI_Hs02_00326419 predicted 672
7 SASI_Hs02_00326420 predicted 809
8 SASI_Hs02_00326421 predicted 546
9 SASI_Hs02_00326422 predicted 1380
10 SASI_Hs02_00326423 predicted 1331
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003629 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00015056 predicted 1164
2 SASI_Hs01_00015057 predicted 1335
3 SASI_Hs01_00015058 predicted 1691
4 SASI_Hs01_00015060 predicted 1218
5 SASI_Hs01_00015062 predicted 1346
6 SASI_Hs01_00015063 predicted 1163
7 SASI_Hs01_00015064 predicted 1307
8 SASI_Hs02_00335977 predicted 1040
9 SASI_Hs02_00335978 predicted 1882
10 SASI_Hs02_00335979 predicted 1830
11 SASI_Hs01_00015059 predicted 747
12 SASI_Hs01_00015061 predicted 753
13 SASI_Hs01_00015065 predicted 749
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022213 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00054781 predicted 793
2 SASI_Rn01_00054782 predicted 756
3 SASI_Rn01_00054783 predicted 637
4 SASI_Rn01_00054784 predicted 518
5 SASI_Rn01_00054785 predicted 992
6 SASI_Rn01_00054786 predicted 407
7 SASI_Rn01_00054787 predicted 576
8 SASI_Rn01_00054788 predicted 653
9 SASI_Rn01_00054789 predicted 764
10 SASI_Rn01_00054790 predicted 336
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181585 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00138189 predicted 1038
2 SASI_Mm01_00138190 predicted 1188
3 SASI_Mm01_00138191 predicted 1089
4 SASI_Mm02_00349847 predicted 1086
5 SASI_Mm01_00138192 predicted 967
6 SASI_Mm01_00138193 predicted 450
7 SASI_Mm01_00138194 predicted 729
8 SASI_Mm01_00138196 predicted 618
9 SASI_Mm01_00138197 predicted 1325
10 SASI_Mm02_00349848 predicted 1278
11 SASI_Mm01_00138195 predicted 1043
12 SASI_Mm01_00138198 predicted 1532
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_181585
PIK3R3 MISSION shRNA Bacterial Glycerol Stock
phosphoinositide-3-kinase, regulatory subunit 3 (gamma)
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000361421    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181585.5-1433s21c1
Sequence:CCGGGATGAGAACCTGCCGCATTATCTCGAGATAATGCGGCAGGTTCTCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361422    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181585.5-1154s21c1
Sequence:CCGGGAGCGAATTATGATGAATTATCTCGAGATAATTCATCATAATTCGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361423    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181585.5-458s21c1
Sequence:CCGGTATTCGACAGAACTGATATTTCTCGAGAAATATCAGTTCTGTCGAATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361352    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181585.5-786s21c1
Sequence:CCGGCTTCTGTGGTGGAGCTTATTACTCGAGTAATAAGCTCCACCACAGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025093    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181585.3-883s1c1
Sequence:CCGGCCAACAGGATCAGTTGGTAAACTCGAGTTTACCAACTGATCCTGTTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025092    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181585.3-1551s1c1
Sequence:CCGGGCAAGAAAGGATGTTACGCTTCTCGAGAAGCGTAACATCCTTTCTTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025091    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181585.3-1441s1c1
Sequence:CCGGCCTGCCGCATTATGATGAGAACTCGAGTTCTCATCATAATGCGGCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025090    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181585.3-454s1c1
Sequence:CCGGGCCCTATTCGACAGAACTGATCTCGAGATCAGTTCTGTCGAATAGGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025089    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181585.3-1153s1c1
Sequence:CCGGCGAGCGAATTATGATGAATTACTCGAGTAATTCATCATAATTCGCTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_181585
PIK3R3 MISSION shRNA shRNA Plasmid DNA
phosphoinositide-3-kinase, regulatory subunit 3 (gamma)
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000361421    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181585.5-1433s21c1
Sequence:CCGGGATGAGAACCTGCCGCATTATCTCGAGATAATGCGGCAGGTTCTCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000361422    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181585.5-1154s21c1
Sequence:CCGGGAGCGAATTATGATGAATTATCTCGAGATAATTCATCATAATTCGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000361423    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181585.5-458s21c1
Sequence:CCGGTATTCGACAGAACTGATATTTCTCGAGAAATATCAGTTCTGTCGAATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000361352    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181585.5-786s21c1
Sequence:CCGGCTTCTGTGGTGGAGCTTATTACTCGAGTAATAAGCTCCACCACAGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025093    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181585.3-883s1c1
Sequence:CCGGCCAACAGGATCAGTTGGTAAACTCGAGTTTACCAACTGATCCTGTTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025092    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181585.3-1551s1c1
Sequence:CCGGGCAAGAAAGGATGTTACGCTTCTCGAGAAGCGTAACATCCTTTCTTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025091    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181585.3-1441s1c1
Sequence:CCGGCCTGCCGCATTATGATGAGAACTCGAGTTCTCATCATAATGCGGCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025090    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181585.3-454s1c1
Sequence:CCGGGCCCTATTCGACAGAACTGATCTCGAGATCAGTTCTGTCGAATAGGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025089    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181585.3-1153s1c1
Sequence:CCGGCGAGCGAATTATGATGAATTACTCGAGTAATTCATCATAATTCGCTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_181585
PIK3R3 MISSION shRNA Lentiviral Transduction Particles
phosphoinositide-3-kinase, regulatory subunit 3 (gamma)
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000361421    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181585.5-1433s21c1
Sequence:CCGGGATGAGAACCTGCCGCATTATCTCGAGATAATGCGGCAGGTTCTCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361422    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181585.5-1154s21c1
Sequence:CCGGGAGCGAATTATGATGAATTATCTCGAGATAATTCATCATAATTCGCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361423    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181585.5-458s21c1
Sequence:CCGGTATTCGACAGAACTGATATTTCTCGAGAAATATCAGTTCTGTCGAATATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361352    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181585.5-786s21c1
Sequence:CCGGCTTCTGTGGTGGAGCTTATTACTCGAGTAATAAGCTCCACCACAGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025093    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181585.3-883s1c1
Sequence:CCGGCCAACAGGATCAGTTGGTAAACTCGAGTTTACCAACTGATCCTGTTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025092    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181585.3-1551s1c1
Sequence:CCGGGCAAGAAAGGATGTTACGCTTCTCGAGAAGCGTAACATCCTTTCTTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025091    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181585.3-1441s1c1
Sequence:CCGGCCTGCCGCATTATGATGAGAACTCGAGTTCTCATCATAATGCGGCAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025090    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181585.3-454s1c1
Sequence:CCGGGCCCTATTCGACAGAACTGATCTCGAGATCAGTTCTGTCGAATAGGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025089    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181585.3-1153s1c1
Sequence:CCGGCGAGCGAATTATGATGAATTACTCGAGTAATTCATCATAATTCGCTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003629
PIK3R3 MISSION shRNA Bacterial Glycerol Stock
phosphoinositide-3-kinase, regulatory subunit 3 (gamma)
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000197032    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_003629.2-3516s1c1
Sequence:CCGGGCTGAGTGAAGCTAGGCAAATCTCGAGATTTGCCTAGCTTCACTCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195671    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003629.2-1760s1c1
Sequence:CCGGCCTGGTTTGTTGAGGATATCACTCGAGTGATATCCTCAACAAACCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195144    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_003629.2-4350s1c1
Sequence:CCGGCAGTCCTACATTCCTTCATTTCTCGAGAAATGAAGGAATGTAGGACTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195110    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_003629.2-5250s1c1
Sequence:CCGGCAACCTCGTTTCCTTACAAATCTCGAGATTTGTAAGGAAACGAGGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033289    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003629.2-1126s1c1
Sequence:CCGGGCTCAGTACAATCCCAAACTTCTCGAGAAGTTTGGGATTGTACTGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033293    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003629.2-1258s1c1
Sequence:CCGGGAGAAGAGTAAAGAGTATGATCTCGAGATCATACTCTTTACTCTTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033292    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003629.2-1826s1c1
Sequence:CCGGCATTCTTAATTCGTGAGAGTACTCGAGTACTCTCACGAATTAAGAATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003629
PIK3R3 MISSION shRNA shRNA Plasmid DNA
phosphoinositide-3-kinase, regulatory subunit 3 (gamma)
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000197032    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_003629.2-3516s1c1
Sequence:CCGGGCTGAGTGAAGCTAGGCAAATCTCGAGATTTGCCTAGCTTCACTCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195671    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003629.2-1760s1c1
Sequence:CCGGCCTGGTTTGTTGAGGATATCACTCGAGTGATATCCTCAACAAACCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195144    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_003629.2-4350s1c1
Sequence:CCGGCAGTCCTACATTCCTTCATTTCTCGAGAAATGAAGGAATGTAGGACTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195110    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_003629.2-5250s1c1
Sequence:CCGGCAACCTCGTTTCCTTACAAATCTCGAGATTTGTAAGGAAACGAGGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033289    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003629.2-1126s1c1
Sequence:CCGGGCTCAGTACAATCCCAAACTTCTCGAGAAGTTTGGGATTGTACTGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033293    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003629.2-1258s1c1
Sequence:CCGGGAGAAGAGTAAAGAGTATGATCTCGAGATCATACTCTTTACTCTTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033292    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003629.2-1826s1c1
Sequence:CCGGCATTCTTAATTCGTGAGAGTACTCGAGTACTCTCACGAATTAAGAATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003629
PIK3R3 MISSION shRNA Lentiviral Transduction Particles
phosphoinositide-3-kinase, regulatory subunit 3 (gamma)
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000197032    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_003629.2-3516s1c1
Sequence:CCGGGCTGAGTGAAGCTAGGCAAATCTCGAGATTTGCCTAGCTTCACTCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195671    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003629.2-1760s1c1
Sequence:CCGGCCTGGTTTGTTGAGGATATCACTCGAGTGATATCCTCAACAAACCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195144    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_003629.2-4350s1c1
Sequence:CCGGCAGTCCTACATTCCTTCATTTCTCGAGAAATGAAGGAATGTAGGACTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195110    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_003629.2-5250s1c1
Sequence:CCGGCAACCTCGTTTCCTTACAAATCTCGAGATTTGTAAGGAAACGAGGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033289    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003629.2-1126s1c1
Sequence:CCGGGCTCAGTACAATCCCAAACTTCTCGAGAAGTTTGGGATTGTACTGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033293    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003629.2-1258s1c1
Sequence:CCGGGAGAAGAGTAAAGAGTATGATCTCGAGATCATACTCTTTACTCTTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033292    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003629.2-1826s1c1
Sequence:CCGGCATTCTTAATTCGTGAGAGTACTCGAGTACTCTCACGAATTAAGAATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)