EMAIL THIS PAGE TO A FRIEND

PIK3R4

phosphoinositide-3-kinase, regulatory subunit 4

141 Gene Product Result for
Synonyms: VPS15 p150
UniProtKB ID: Q99570, Q2TBF4
Gene ID:
Mouse(75669) phosphatidylinositol 3 kinase, regulatory subunit, polypeptide 4, p150
Rat(363131) phosphoinositide-3-kinase, regulatory subunit 4
Zebrafish(564088) phosphoinositide-3-kinase, regulatory subunit 4
chicken(428449) phosphoinositide-3-kinase, regulatory subunit 4
Horse(100052647) phosphoinositide-3-kinase, regulatory subunit 4
domestic cat(101091893) phosphoinositide-3-kinase, regulatory subunit 4
dog(477064) phosphoinositide-3-kinase, regulatory subunit 4
domestic guinea pig(100724689) phosphoinositide-3-kinase, regulatory subunit 4
naked mole-rat(101707122) phosphoinositide-3-kinase, regulatory subunit 4
cow(507414) phosphoinositide-3-kinase, regulatory subunit 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014602 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014602 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014602 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001081309 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081309 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081309 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-XM_135116 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_135116 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_135116 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014602 siRNAs that have been validated in the lab human pricing
NM_001108777 Rosetta Predictions rat pricing
NM_001081309 Rosetta Predictions mouse pricing
XM_135116 Rosetta Predictions mouse pricing
XM_889806 Rosetta Predictions mouse pricing
XM_898643 Rosetta Predictions mouse pricing
XM_898651 Rosetta Predictions mouse pricing
XM_898663 Rosetta Predictions mouse pricing
XM_898671 Rosetta Predictions mouse pricing
XM_898688 Rosetta Predictions mouse pricing
XM_898695 Rosetta Predictions mouse pricing
XM_898703 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014602 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_WI_00000052 validated 417
1 SASI_WI_00000053 validated 1122
1 SASI_WI_00000054 validated 2750
2 SASI_Hs01_00181672 predicted 3738
3 SASI_Hs01_00181673 predicted 1596
4 SASI_Hs01_00181674 predicted 2282
5 SASI_Hs01_00181676 predicted 2580
6 SASI_Hs01_00181677 predicted 1055
7 SASI_Hs01_00181678 predicted 3512
8 SASI_Hs01_00181679 predicted 1915
9 SASI_Hs01_00181680 predicted 1162
10 SASI_Hs01_00181681 predicted 1825
11 SASI_Hs02_00345888 predicted 3689
12 SASI_Hs01_00181675 predicted 3935
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108777 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00241975 predicted 425
2 SASI_Rn02_00241976 predicted 2592
3 SASI_Rn02_00241977 predicted 3572
4 SASI_Rn02_00241978 predicted 2897
5 SASI_Rn02_00241979 predicted 1082
6 SASI_Rn02_00241980 predicted 4201
7 SASI_Rn02_00241981 predicted 4504
8 SASI_Rn02_00241982 predicted 3532
9 SASI_Rn02_00241983 predicted 3357
10 SASI_Rn02_00241984 predicted 2415
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081309 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00297171 predicted 3601
2 SASI_Mm02_00297172 predicted 612
3 SASI_Mm02_00297173 predicted 3599
4 SASI_Mm02_00297174 predicted 4605
5 SASI_Mm02_00297175 predicted 3641
6 SASI_Mm02_00297176 predicted 2921
7 SASI_Mm02_00297177 predicted 3546
8 SASI_Mm02_00297178 predicted 4256
9 SASI_Mm02_00297179 predicted 1963
10 SASI_Mm02_00297180 predicted 4460
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_135116 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00225825 predicted 937
2 SASI_Mm01_00225826 predicted 629
3 SASI_Mm01_00225827 predicted 1989
4 SASI_Mm01_00225828 predicted 1504
5 SASI_Mm01_00225829 predicted 1202
6 SASI_Mm01_00225830 predicted 1497
7 SASI_Mm01_00225831 predicted 2017
8 SASI_Mm01_00225832 predicted 905
9 SASI_Mm01_00225833 predicted 639
10 SASI_Mm01_00225834 predicted 1309
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_889806 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00283553 predicted 614
2 SASI_Mm01_00283554 predicted 1804
3 SASI_Mm01_00283555 predicted 4266
4 SASI_Mm01_00283556 predicted 1968
5 SASI_Mm01_00283557 predicted 1603
6 SASI_Mm01_00283558 predicted 1292
7 SASI_Mm01_00283559 predicted 1192
8 SASI_Mm01_00283560 predicted 4473
9 SASI_Mm01_00283561 predicted 1481
10 SASI_Mm01_00283562 predicted 1236
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_898643 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00202220 predicted 612
2 SASI_Mm01_00202221 predicted 763
3 SASI_Mm01_00202222 predicted 611
4 SASI_Mm01_00202223 predicted 733
5 SASI_Mm01_00202224 predicted 622
6 SASI_Mm01_00202225 predicted 947
7 SASI_Mm01_00202226 predicted 731
8 SASI_Mm01_00202227 predicted 735
9 SASI_Mm01_00202228 predicted 983
10 SASI_Mm01_00202229 predicted 1048
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_898651 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00245831 predicted 928
2 SASI_Mm01_00245832 predicted 614
3 SASI_Mm01_00245833 predicted 1493
4 SASI_Mm01_00245834 predicted 1186
5 SASI_Mm01_00245835 predicted 1479
6 SASI_Mm01_00245836 predicted 898
7 SASI_Mm01_00245837 predicted 628
8 SASI_Mm01_00245838 predicted 1285
9 SASI_Mm01_00245839 predicted 1051
10 SASI_Mm01_00245840 predicted 1051
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_898663 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00209669 predicted 371
2 SASI_Mm01_00209670 predicted 366
3 SASI_Mm01_00209671 predicted 360
4 SASI_Mm01_00209672 predicted 358
5 SASI_Mm01_00209673 predicted 287
6 SASI_Mm01_00209674 predicted 281
7 SASI_Mm01_00209675 predicted 363
8 SASI_Mm01_00209676 predicted 400
9 SASI_Mm01_00209677 predicted 308
10 SASI_Mm01_00209678 predicted 364
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_898671 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00281260 predicted 1724
2 SASI_Mm01_00281261 predicted 1418
3 SASI_Mm01_00281262 predicted 2772
4 SASI_Mm01_00281263 predicted 2293
5 SASI_Mm01_00281264 predicted 1988
6 SASI_Mm01_00281265 predicted 2281
7 SASI_Mm01_00281266 predicted 2807
8 SASI_Mm01_00281267 predicted 1700
9 SASI_Mm01_00281268 predicted 1429
10 SASI_Mm01_00281269 predicted 2096
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_898688 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00207860 predicted 710
2 SASI_Mm01_00207861 predicted 581
3 SASI_Mm01_00207862 predicted 692
4 SASI_Mm01_00207863 predicted 610
5 SASI_Mm01_00207864 predicted 607
6 SASI_Mm01_00207865 predicted 634
7 SASI_Mm01_00207866 predicted 500
8 SASI_Mm01_00207867 predicted 526
9 SASI_Mm01_00207868 predicted 701
10 SASI_Mm01_00207869 predicted 618
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_898695 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00258568 predicted 266
2 SASI_Mm01_00258569 predicted 1450
3 SASI_Mm01_00258570 predicted 3912
4 SASI_Mm01_00258571 predicted 1617
5 SASI_Mm01_00258572 predicted 1250
6 SASI_Mm01_00258573 predicted 950
7 SASI_Mm01_00258574 predicted 835
8 SASI_Mm01_00258575 predicted 4125
9 SASI_Mm01_00258576 predicted 1131
10 SASI_Mm01_00258577 predicted 882
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_898703 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00234669 predicted 645
2 SASI_Mm01_00234670 predicted 1830
3 SASI_Mm01_00234671 predicted 4291
4 SASI_Mm01_00234672 predicted 1999
5 SASI_Mm01_00234673 predicted 1636
6 SASI_Mm01_00234674 predicted 1332
7 SASI_Mm01_00234675 predicted 1222
8 SASI_Mm01_00234676 predicted 4505
9 SASI_Mm01_00234677 predicted 1512
10 SASI_Mm01_00234678 predicted 1264
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014602
VALIDATED
PIK3R4 MISSION shRNA Bacterial Glycerol Stock
phosphoinositide-3-kinase, regulatory subunit 4
Human
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000318621    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014602.2-1152s21c1
Sequence:CCGGCGGAGGAGAACTTGCTATATTCTCGAGAATATAGCAAGTTCTCCTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010562    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_014602.x-1113s1c1
Sequence:CCGGCGGAGGAGAACTTGCTATATTCTCGAGAATATAGCAAGTTCTCCTCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379837    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014602.2-3018s21c1
Sequence:GTACCGGAGTAGTCAGAAAGGTGTAATTCTCGAGAATTACACCTTTCTGACTACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000885    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_014602.x-4724s1c1
Sequence:CCGGGTCTCCATATTACTGTTTCATCTCGAGATGAAACAGTAATATGGAGACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000886    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_014602.x-1361s1c1
Sequence:CCGGCCCTGAACAAGTGCTAAATAACTCGAGTTATTTAGCACTTGTTCAGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000888    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_014602.x-4227s1c1
Sequence:CCGGGCACCACCACTTTCTGAATTACTCGAGTAATTCAGAAAGTGGTGGTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000887    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014602.x-2527s1c1
Sequence:CCGGCCTTCCTGTGTCATCCCAATTCTCGAGAATTGGGATGACACAGGAAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318693    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014602.2-1400s21c1
Sequence:CCGGCCCTGAACAAGTGCTAAATAACTCGAGTTATTTAGCACTTGTTCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318625    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014602.2-4842s21c1
Sequence:CCGGGCATCTCTTTGCAAGAATCAGCTCGAGCTGATTCTTGCAAAGAGATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318694    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014602.2-4813s21c1
Sequence:CCGGGTTAAGATGTACTTGACTAGTCTCGAGACTAGTCAAGTACATCTTAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318623    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014602.2-4266s21c1
Sequence:CCGGGCACCACCACTTTCTGAATTACTCGAGTAATTCAGAAAGTGGTGGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197017    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014602.1-4803s1c1
Sequence:CCGGGCATCTCTTTGCAAGAATCAGCTCGAGCTGATTCTTGCAAAGAGATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196467    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014602.1-4774s1c1
Sequence:CCGGGTTAAGATGTACTTGACTAGTCTCGAGACTAGTCAAGTACATCTTAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196772    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_014602.1-4852s1c1
Sequence:CCGGGTATATGTTATAGAGGTGAGACTCGAGTCTCACCTCTATAACATATACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195336    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_014602.1-4814s1c1
Sequence:CCGGCAAGAATCAGCCAGCCAACAACTCGAGTTGTTGGCTGGCTGATTCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014602
VALIDATED
PIK3R4 MISSION shRNA shRNA Plasmid DNA
phosphoinositide-3-kinase, regulatory subunit 4
Human
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000318621    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014602.2-1152s21c1
Sequence:CCGGCGGAGGAGAACTTGCTATATTCTCGAGAATATAGCAAGTTCTCCTCCGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000010562    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_014602.x-1113s1c1
Sequence:CCGGCGGAGGAGAACTTGCTATATTCTCGAGAATATAGCAAGTTCTCCTCCGTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000379837    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014602.2-3018s21c1
Sequence:GTACCGGAGTAGTCAGAAAGGTGTAATTCTCGAGAATTACACCTTTCTGACTACTTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000000885    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_014602.x-4724s1c1
Sequence:CCGGGTCTCCATATTACTGTTTCATCTCGAGATGAAACAGTAATATGGAGACTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000000886    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_014602.x-1361s1c1
Sequence:CCGGCCCTGAACAAGTGCTAAATAACTCGAGTTATTTAGCACTTGTTCAGGGTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000000888    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_014602.x-4227s1c1
Sequence:CCGGGCACCACCACTTTCTGAATTACTCGAGTAATTCAGAAAGTGGTGGTGCTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000000887    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014602.x-2527s1c1
Sequence:CCGGCCTTCCTGTGTCATCCCAATTCTCGAGAATTGGGATGACACAGGAAGGTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000318693    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014602.2-1400s21c1
Sequence:CCGGCCCTGAACAAGTGCTAAATAACTCGAGTTATTTAGCACTTGTTCAGGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000318625    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014602.2-4842s21c1
Sequence:CCGGGCATCTCTTTGCAAGAATCAGCTCGAGCTGATTCTTGCAAAGAGATGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000318694    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014602.2-4813s21c1
Sequence:CCGGGTTAAGATGTACTTGACTAGTCTCGAGACTAGTCAAGTACATCTTAACTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000318623    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014602.2-4266s21c1
Sequence:CCGGGCACCACCACTTTCTGAATTACTCGAGTAATTCAGAAAGTGGTGGTGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000197017    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014602.1-4803s1c1
Sequence:CCGGGCATCTCTTTGCAAGAATCAGCTCGAGCTGATTCTTGCAAAGAGATGCTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000196467    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014602.1-4774s1c1
Sequence:CCGGGTTAAGATGTACTTGACTAGTCTCGAGACTAGTCAAGTACATCTTAACTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000196772    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_014602.1-4852s1c1
Sequence:CCGGGTATATGTTATAGAGGTGAGACTCGAGTCTCACCTCTATAACATATACTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000195336    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_014602.1-4814s1c1
Sequence:CCGGCAAGAATCAGCCAGCCAACAACTCGAGTTGTTGGCTGGCTGATTCTTGTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014602
VALIDATED
PIK3R4 MISSION shRNA Lentiviral Transduction Particles
phosphoinositide-3-kinase, regulatory subunit 4
Human
15 Products Total
TRC Number Volume Titer/mL Vector Price Set Price (5+)? Select
TRCN0000318621    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014602.2-1152s21c1
Sequence:CCGGCGGAGGAGAACTTGCTATATTCTCGAGAATATAGCAAGTTCTCCTCCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010562    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_014602.x-1113s1c1
Sequence:CCGGCGGAGGAGAACTTGCTATATTCTCGAGAATATAGCAAGTTCTCCTCCGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000379837    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014602.2-3018s21c1
Sequence:GTACCGGAGTAGTCAGAAAGGTGTAATTCTCGAGAATTACACCTTTCTGACTACTTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000885    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_014602.x-4724s1c1
Sequence:CCGGGTCTCCATATTACTGTTTCATCTCGAGATGAAACAGTAATATGGAGACTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000886    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_014602.x-1361s1c1
Sequence:CCGGCCCTGAACAAGTGCTAAATAACTCGAGTTATTTAGCACTTGTTCAGGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000888    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_014602.x-4227s1c1
Sequence:CCGGGCACCACCACTTTCTGAATTACTCGAGTAATTCAGAAAGTGGTGGTGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000887    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014602.x-2527s1c1
Sequence:CCGGCCTTCCTGTGTCATCCCAATTCTCGAGAATTGGGATGACACAGGAAGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000318693    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014602.2-1400s21c1
Sequence:CCGGCCCTGAACAAGTGCTAAATAACTCGAGTTATTTAGCACTTGTTCAGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000318625    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014602.2-4842s21c1
Sequence:CCGGGCATCTCTTTGCAAGAATCAGCTCGAGCTGATTCTTGCAAAGAGATGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000318694    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014602.2-4813s21c1
Sequence:CCGGGTTAAGATGTACTTGACTAGTCTCGAGACTAGTCAAGTACATCTTAACTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000318623    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014602.2-4266s21c1
Sequence:CCGGGCACCACCACTTTCTGAATTACTCGAGTAATTCAGAAAGTGGTGGTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000197017    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014602.1-4803s1c1
Sequence:CCGGGCATCTCTTTGCAAGAATCAGCTCGAGCTGATTCTTGCAAAGAGATGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196467    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014602.1-4774s1c1
Sequence:CCGGGTTAAGATGTACTTGACTAGTCTCGAGACTAGTCAAGTACATCTTAACTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196772    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_014602.1-4852s1c1
Sequence:CCGGGTATATGTTATAGAGGTGAGACTCGAGTCTCACCTCTATAACATATACTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195336    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_014602.1-4814s1c1
Sequence:CCGGCAAGAATCAGCCAGCCAACAACTCGAGTTGTTGGCTGGCTGATTCTTGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081309
PIK3R4 MISSION shRNA Bacterial Glycerol Stock
phosphoinositide-3-kinase, regulatory subunit 4
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000280537    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081309.1-1257s21c1
Sequence:CCGGCCTGAACAAGTGCTAAACAAACTCGAGTTTGTTTAGCACTTGTTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280476    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081309.1-476s21c1
Sequence:CCGGCCTGTCTGTAGAGAGTTATTTCTCGAGAAATAACTCTCTACAGACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345040    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081309.1-1476s21c1
Sequence:CCGGCGGAAAGATTTGGGCAACATTCTCGAGAATGTTGCCCAAATCTTTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280536    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081309.1-1794s21c1
Sequence:CCGGCGCAACGATGTCAATATCTATCTCGAGATAGATATTGACATCGTTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081309
PIK3R4 MISSION shRNA shRNA Plasmid DNA
phosphoinositide-3-kinase, regulatory subunit 4
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000280537    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081309.1-1257s21c1
Sequence:CCGGCCTGAACAAGTGCTAAACAAACTCGAGTTTGTTTAGCACTTGTTCAGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000280476    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081309.1-476s21c1
Sequence:CCGGCCTGTCTGTAGAGAGTTATTTCTCGAGAAATAACTCTCTACAGACAGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000345040    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081309.1-1476s21c1
Sequence:CCGGCGGAAAGATTTGGGCAACATTCTCGAGAATGTTGCCCAAATCTTTCCGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000280536    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081309.1-1794s21c1
Sequence:CCGGCGCAACGATGTCAATATCTATCTCGAGATAGATATTGACATCGTTGCGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081309
PIK3R4 MISSION shRNA Lentiviral Transduction Particles
phosphoinositide-3-kinase, regulatory subunit 4
Mouse
4 Products Total
TRC Number Volume Titer/mL Vector Price Set Price (4)? Select
TRCN0000280537    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081309.1-1257s21c1
Sequence:CCGGCCTGAACAAGTGCTAAACAAACTCGAGTTTGTTTAGCACTTGTTCAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000280476    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081309.1-476s21c1
Sequence:CCGGCCTGTCTGTAGAGAGTTATTTCTCGAGAAATAACTCTCTACAGACAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000345040    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081309.1-1476s21c1
Sequence:CCGGCGGAAAGATTTGGGCAACATTCTCGAGAATGTTGCCCAAATCTTTCCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000280536    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081309.1-1794s21c1
Sequence:CCGGCGCAACGATGTCAATATCTATCTCGAGATAGATATTGACATCGTTGCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_135116
VALIDATED
PIK3R4 MISSION shRNA Bacterial Glycerol Stock
phosphoinositide-3-kinase, regulatory subunit 4
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000027037    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_135116.4-463s1c1
Sequence:CCGGCCTGTCTGTAGAGAGTTATTTCTCGAGAAATAACTCTCTACAGACAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027018    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_135116.4-1244s1c1
Sequence:CCGGCCTGAACAAGTGCTAAACAAACTCGAGTTTGTTTAGCACTTGTTCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026968    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_135116.4-1463s1c1
Sequence:CCGGCGGAAAGATTTGGGCAACATTCTCGAGAATGTTGCCCAAATCTTTCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026992    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_135116.4-1781s1c1
Sequence:CCGGCGCAACGATGTCAATATCTATCTCGAGATAGATATTGACATCGTTGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026984    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_135116.4-961s1c1
Sequence:CCGGCCCAGCGGATTTCAACTATTTCTCGAGAAATAGTTGAAATCCGCTGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_135116
VALIDATED
PIK3R4 MISSION shRNA shRNA Plasmid DNA
phosphoinositide-3-kinase, regulatory subunit 4
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000027037    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_135116.4-463s1c1
Sequence:CCGGCCTGTCTGTAGAGAGTTATTTCTCGAGAAATAACTCTCTACAGACAGGTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000027018    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_135116.4-1244s1c1
Sequence:CCGGCCTGAACAAGTGCTAAACAAACTCGAGTTTGTTTAGCACTTGTTCAGGTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000026968    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_135116.4-1463s1c1
Sequence:CCGGCGGAAAGATTTGGGCAACATTCTCGAGAATGTTGCCCAAATCTTTCCGTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000026992    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_135116.4-1781s1c1
Sequence:CCGGCGCAACGATGTCAATATCTATCTCGAGATAGATATTGACATCGTTGCGTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000026984    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_135116.4-961s1c1
Sequence:CCGGCCCAGCGGATTTCAACTATTTCTCGAGAAATAGTTGAAATCCGCTGGGTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_135116
VALIDATED
PIK3R4 MISSION shRNA Lentiviral Transduction Particles
phosphoinositide-3-kinase, regulatory subunit 4
Mouse
5 Products Total
TRC Number Volume Titer/mL Vector Price Set Price (5+)? Select
TRCN0000027037    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_135116.4-463s1c1
Sequence:CCGGCCTGTCTGTAGAGAGTTATTTCTCGAGAAATAACTCTCTACAGACAGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027018    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_135116.4-1244s1c1
Sequence:CCGGCCTGAACAAGTGCTAAACAAACTCGAGTTTGTTTAGCACTTGTTCAGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026968    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_135116.4-1463s1c1
Sequence:CCGGCGGAAAGATTTGGGCAACATTCTCGAGAATGTTGCCCAAATCTTTCCGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026992    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_135116.4-1781s1c1
Sequence:CCGGCGCAACGATGTCAATATCTATCTCGAGATAGATATTGACATCGTTGCGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026984    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_135116.4-961s1c1
Sequence:CCGGCCCAGCGGATTTCAACTATTTCTCGAGAAATAGTTGAAATCCGCTGGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)