EMAIL THIS PAGE TO A FRIEND

PIK3R5

phosphoinositide-3-kinase, regulatory subunit 5

60 Gene Product Result for
Synonyms: F730038I15Rik FOAP-2 P101-PI3K p101
Gene ID:
Human(23533) Summary: Phosphatidylinositol 3-kinases (PI3Ks) phosphorylate the inositol ring of phosphatidylinositol at the 3-prime position, and play important roles in cell growth, proliferation, differentiation, motility, survival and intracellular trafficking. The PI3Ks are divided into three classes: I, II and III, and only the class I PI3Ks are involved in oncogenesis. This gene encodes the 101 kD regulatory subunit of the class I PI3K gamma complex, which is a dimeric enzyme, consisting of a 110 kD catalytic subunit gamma and a regulatory subunit of either 55, 87 or 101 kD. This protein recruits the catalytic subunit from the cytosol to the plasma membrane through high-affinity interaction with G-beta-gamma proteins. Multiple alternatively spliced transcript variants encoding two distinct isoforms have been found. [provided by RefSeq, Oct 2011]
Mouse(320207) phosphoinositide-3-kinase, regulatory subunit 5, p101
Rat(497931) phosphoinositide-3-kinase, regulatory subunit 5
cow(614838) phosphoinositide-3-kinase, regulatory subunit 5
sheep(101109983) phosphoinositide-3-kinase, regulatory subunit 5
naked mole-rat(101721762) phosphoinositide-3-kinase, regulatory subunit 5
Domestic Rabbit(100337757) phosphoinositide-3-kinase, regulatory subunit 5
domestic guinea pig(100729793) phosphoinositide-3-kinase, regulatory subunit 5
Zebrafish(323588) phosphoinositide-3-kinase, regulatory subunit 5
chicken(417319) phosphoinositide 3-kinase regulatory subunit 5
Horse(100062810) phosphoinositide-3-kinase, regulatory subunit 5
domestic cat(101082354) phosphoinositide-3-kinase, regulatory subunit 5
dog(612805) phosphoinositide-3-kinase, regulatory subunit 5
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_177320 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177320 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177320 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_014308 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014308 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014308 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014308 Rosetta Predictions human pricing
XM_001078987 Rosetta Predictions rat pricing
XM_573118 Rosetta Predictions rat pricing
NM_177320 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014308 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00177657 predicted 2233
2 SASI_Hs01_00177658 predicted 2386
3 SASI_Hs01_00177659 predicted 2480
4 SASI_Hs01_00177660 predicted 2434
5 SASI_Hs01_00177661 predicted 2024
6 SASI_Hs01_00177662 predicted 1627
7 SASI_Hs01_00177663 predicted 316
8 SASI_Hs01_00177664 predicted 2428
9 SASI_Hs01_00177665 predicted 2242
10 SASI_Hs01_00177666 predicted 1919
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001078987 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00362745 predicted 2101
2 SASI_Rn02_00362746 predicted 1394
3 SASI_Rn02_00362747 predicted 2307
4 SASI_Rn02_00362748 predicted 1130
5 SASI_Rn02_00362749 predicted 1140
6 SASI_Rn02_00362750 predicted 783
7 SASI_Rn02_00362751 predicted 515
8 SASI_Rn02_00362752 predicted 1018
9 SASI_Rn02_00362753 predicted 2508
10 SASI_Rn02_00362754 predicted 2599
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_573118 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00399864 predicted 2095
2 SASI_Rn02_00399865 predicted 1385
3 SASI_Rn02_00399866 predicted 2303
4 SASI_Rn02_00399867 predicted 1135
5 SASI_Rn02_00399868 predicted 1140
6 SASI_Rn02_00399869 predicted 780
7 SASI_Rn02_00399870 predicted 517
8 SASI_Rn02_00399871 predicted 1014
9 SASI_Rn02_00399872 predicted 2508
10 SASI_Rn02_00399873 predicted 2600
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177320 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00084185 predicted 2092
2 SASI_Mm01_00084186 predicted 2540
3 SASI_Mm01_00084187 predicted 2828
4 SASI_Mm01_00084189 predicted 2846
5 SASI_Mm01_00084190 predicted 1688
6 SASI_Mm01_00084191 predicted 773
7 SASI_Mm01_00084192 predicted 791
8 SASI_Mm01_00084193 predicted 2262
9 SASI_Mm01_00084194 predicted 2500
10 SASI_Mm02_00347413 predicted 2299
11 SASI_Mm01_00084188 predicted 1400
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177320
PIK3R5 MISSION shRNA Bacterial Glycerol Stock
phosphoinositide-3-kinase, regulatory subunit 5
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000362374    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177320.2-2472s21c1
Sequence:CCGGTGAAGAGGCAGAACCCTAAATCTCGAGATTTAGGGTTCTGCCTCTTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362298    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177320.2-1692s21c1
Sequence:CCGGTCTTTGGCTCTGATCGGATTTCTCGAGAAATCCGATCAGAGCCAAAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362385    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177320.2-1397s21c1
Sequence:CCGGAGGTTCTATAAACTCTTAAAGCTCGAGCTTTAAGAGTTTATAGAACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088608    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177320.1-2151s1c1
Sequence:CCGGCGTCCCTCTAACACTACAGATCTCGAGATCTGTAGTGTTAGAGGGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177320.1-2152s1c1
Sequence:CCGGGTCCCTCTAACACTACAGATTCTCGAGAATCTGTAGTGTTAGAGGGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362372    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177320.2-2306s21c1
Sequence:CCGGCCTCTAACACTACAGATTATTCTCGAGAATAATCTGTAGTGTTAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088609    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177320.1-1233s1c1
Sequence:CCGGGCAGAAGTTCAACAGGTTCTACTCGAGTAGAACCTGTTGAACTTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177320.1-647s1c1
Sequence:CCGGGCAAACTTCAGTCCAAGACAACTCGAGTTGTCTTGGACTGAAGTTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088610    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177320.1-2358s1c1
Sequence:CCGGCCAGATCAGTACATCCTACATCTCGAGATGTAGGATGTACTGATCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177320
PIK3R5 MISSION shRNA shRNA Plasmid DNA
phosphoinositide-3-kinase, regulatory subunit 5
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000362374    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177320.2-2472s21c1
Sequence:CCGGTGAAGAGGCAGAACCCTAAATCTCGAGATTTAGGGTTCTGCCTCTTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000362298    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177320.2-1692s21c1
Sequence:CCGGTCTTTGGCTCTGATCGGATTTCTCGAGAAATCCGATCAGAGCCAAAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000362385    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177320.2-1397s21c1
Sequence:CCGGAGGTTCTATAAACTCTTAAAGCTCGAGCTTTAAGAGTTTATAGAACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088608    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177320.1-2151s1c1
Sequence:CCGGCGTCCCTCTAACACTACAGATCTCGAGATCTGTAGTGTTAGAGGGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177320.1-2152s1c1
Sequence:CCGGGTCCCTCTAACACTACAGATTCTCGAGAATCTGTAGTGTTAGAGGGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000362372    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177320.2-2306s21c1
Sequence:CCGGCCTCTAACACTACAGATTATTCTCGAGAATAATCTGTAGTGTTAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088609    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177320.1-1233s1c1
Sequence:CCGGGCAGAAGTTCAACAGGTTCTACTCGAGTAGAACCTGTTGAACTTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177320.1-647s1c1
Sequence:CCGGGCAAACTTCAGTCCAAGACAACTCGAGTTGTCTTGGACTGAAGTTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088610    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177320.1-2358s1c1
Sequence:CCGGCCAGATCAGTACATCCTACATCTCGAGATGTAGGATGTACTGATCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177320
PIK3R5 MISSION shRNA Lentiviral Transduction Particles
phosphoinositide-3-kinase, regulatory subunit 5
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000362374    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177320.2-2472s21c1
Sequence:CCGGTGAAGAGGCAGAACCCTAAATCTCGAGATTTAGGGTTCTGCCTCTTCATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000362298    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177320.2-1692s21c1
Sequence:CCGGTCTTTGGCTCTGATCGGATTTCTCGAGAAATCCGATCAGAGCCAAAGATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000362385    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177320.2-1397s21c1
Sequence:CCGGAGGTTCTATAAACTCTTAAAGCTCGAGCTTTAAGAGTTTATAGAACCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088608    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177320.1-2151s1c1
Sequence:CCGGCGTCCCTCTAACACTACAGATCTCGAGATCTGTAGTGTTAGAGGGACGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177320.1-2152s1c1
Sequence:CCGGGTCCCTCTAACACTACAGATTCTCGAGAATCTGTAGTGTTAGAGGGACTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000362372    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177320.2-2306s21c1
Sequence:CCGGCCTCTAACACTACAGATTATTCTCGAGAATAATCTGTAGTGTTAGAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088609    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177320.1-1233s1c1
Sequence:CCGGGCAGAAGTTCAACAGGTTCTACTCGAGTAGAACCTGTTGAACTTCTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177320.1-647s1c1
Sequence:CCGGGCAAACTTCAGTCCAAGACAACTCGAGTTGTCTTGGACTGAAGTTTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088610    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177320.1-2358s1c1
Sequence:CCGGCCAGATCAGTACATCCTACATCTCGAGATGTAGGATGTACTGATCTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014308
VALIDATED
PIK3R5 MISSION shRNA Bacterial Glycerol Stock
phosphoinositide-3-kinase, regulatory subunit 5
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000195068    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014308.1-2243s1c1
Sequence:CCGGCCTCTAACACTACAGATTATTCTCGAGAATAATCTGTAGTGTTAGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195530    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014308.1-2985s1c1
Sequence:CCGGCCTGACCATTAGCATGGTCTACTCGAGTAGACCATGCTAATGGTCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195663    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014308.1-2780s1c1
Sequence:CCGGCTCTCTGTGGAGAACTGAATGCTCGAGCATTCAGTTCTCCACAGAGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199372    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014308.1-1184s1c1
Sequence:CCGGCGCCATCTGCTGACTTCCTTTCTCGAGAAAGGAAGTCAGCAGATGGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033270    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014308.1-446s1c1
Sequence:CCGGCTCACCTTCATTGATGCTGAACTCGAGTTCAGCATCAATGAAGGTGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033271    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014308.1-1333s1c1
Sequence:CCGGCAGGATCTATAAACTCTTCAACTCGAGTTGAAGAGTTTATAGATCCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033272    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014308.1-597s1c1
Sequence:CCGGCTGTAGCCAATAAGCTGAGTACTCGAGTACTCAGCTTATTGGCTACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033273    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014308.1-2384s1c1
Sequence:CCGGCTGACGCTAAACCTGACAGAACTCGAGTTCTGTCAGGTTTAGCGTCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304058    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014308.3-3090s21c1
Sequence:CCGGCCCTTACTTTGCCAAAGACTTCTCGAGAAGTCTTTGGCAAAGTAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300450    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014308.3-2416s21c1
Sequence:CCGGGCAGAACTCCAAATCCAAGAACTCGAGTTCTTGGATTTGGAGTTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304059    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014308.3-2780s21c1
Sequence:CCGGCTCTCTGTGGAGAACTGAATGCTCGAGCATTCAGTTCTCCACAGAGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300371    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014308.3-1333s21c1
Sequence:CCGGCAGGATCTATAAACTCTTCAACTCGAGTTGAAGAGTTTATAGATCCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195514    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014308.1-3090s1c1
Sequence:CCGGCCCTTACTTTGCCAAAGACTTCTCGAGAAGTCTTTGGCAAAGTAAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300448    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014308.3-597s21c1
Sequence:CCGGCTGTAGCCAATAAGCTGAGTACTCGAGTACTCAGCTTATTGGCTACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014308
VALIDATED
PIK3R5 MISSION shRNA shRNA Plasmid DNA
phosphoinositide-3-kinase, regulatory subunit 5
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000195068    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014308.1-2243s1c1
Sequence:CCGGCCTCTAACACTACAGATTATTCTCGAGAATAATCTGTAGTGTTAGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195530    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014308.1-2985s1c1
Sequence:CCGGCCTGACCATTAGCATGGTCTACTCGAGTAGACCATGCTAATGGTCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195663    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014308.1-2780s1c1
Sequence:CCGGCTCTCTGTGGAGAACTGAATGCTCGAGCATTCAGTTCTCCACAGAGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199372    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014308.1-1184s1c1
Sequence:CCGGCGCCATCTGCTGACTTCCTTTCTCGAGAAAGGAAGTCAGCAGATGGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033270    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014308.1-446s1c1
Sequence:CCGGCTCACCTTCATTGATGCTGAACTCGAGTTCAGCATCAATGAAGGTGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033271    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014308.1-1333s1c1
Sequence:CCGGCAGGATCTATAAACTCTTCAACTCGAGTTGAAGAGTTTATAGATCCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033272    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014308.1-597s1c1
Sequence:CCGGCTGTAGCCAATAAGCTGAGTACTCGAGTACTCAGCTTATTGGCTACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033273    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014308.1-2384s1c1
Sequence:CCGGCTGACGCTAAACCTGACAGAACTCGAGTTCTGTCAGGTTTAGCGTCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000304058    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014308.3-3090s21c1
Sequence:CCGGCCCTTACTTTGCCAAAGACTTCTCGAGAAGTCTTTGGCAAAGTAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000300450    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014308.3-2416s21c1
Sequence:CCGGGCAGAACTCCAAATCCAAGAACTCGAGTTCTTGGATTTGGAGTTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000304059    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014308.3-2780s21c1
Sequence:CCGGCTCTCTGTGGAGAACTGAATGCTCGAGCATTCAGTTCTCCACAGAGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000300371    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014308.3-1333s21c1
Sequence:CCGGCAGGATCTATAAACTCTTCAACTCGAGTTGAAGAGTTTATAGATCCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195514    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014308.1-3090s1c1
Sequence:CCGGCCCTTACTTTGCCAAAGACTTCTCGAGAAGTCTTTGGCAAAGTAAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000300448    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014308.3-597s21c1
Sequence:CCGGCTGTAGCCAATAAGCTGAGTACTCGAGTACTCAGCTTATTGGCTACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014308
VALIDATED
PIK3R5 MISSION shRNA Lentiviral Transduction Particles
phosphoinositide-3-kinase, regulatory subunit 5
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000195068    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014308.1-2243s1c1
Sequence:CCGGCCTCTAACACTACAGATTATTCTCGAGAATAATCTGTAGTGTTAGAGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195530    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014308.1-2985s1c1
Sequence:CCGGCCTGACCATTAGCATGGTCTACTCGAGTAGACCATGCTAATGGTCAGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195663    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014308.1-2780s1c1
Sequence:CCGGCTCTCTGTGGAGAACTGAATGCTCGAGCATTCAGTTCTCCACAGAGAGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199372    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014308.1-1184s1c1
Sequence:CCGGCGCCATCTGCTGACTTCCTTTCTCGAGAAAGGAAGTCAGCAGATGGCGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033270    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014308.1-446s1c1
Sequence:CCGGCTCACCTTCATTGATGCTGAACTCGAGTTCAGCATCAATGAAGGTGAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033271    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014308.1-1333s1c1
Sequence:CCGGCAGGATCTATAAACTCTTCAACTCGAGTTGAAGAGTTTATAGATCCTGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033272    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014308.1-597s1c1
Sequence:CCGGCTGTAGCCAATAAGCTGAGTACTCGAGTACTCAGCTTATTGGCTACAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033273    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014308.1-2384s1c1
Sequence:CCGGCTGACGCTAAACCTGACAGAACTCGAGTTCTGTCAGGTTTAGCGTCAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000304058    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014308.3-3090s21c1
Sequence:CCGGCCCTTACTTTGCCAAAGACTTCTCGAGAAGTCTTTGGCAAAGTAAGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000300450    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014308.3-2416s21c1
Sequence:CCGGGCAGAACTCCAAATCCAAGAACTCGAGTTCTTGGATTTGGAGTTCTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000304059    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014308.3-2780s21c1
Sequence:CCGGCTCTCTGTGGAGAACTGAATGCTCGAGCATTCAGTTCTCCACAGAGAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000300371    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014308.3-1333s21c1
Sequence:CCGGCAGGATCTATAAACTCTTCAACTCGAGTTGAAGAGTTTATAGATCCTGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195514    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014308.1-3090s1c1
Sequence:CCGGCCCTTACTTTGCCAAAGACTTCTCGAGAAGTCTTTGGCAAAGTAAGGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000300448    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014308.3-597s21c1
Sequence:CCGGCTGTAGCCAATAAGCTGAGTACTCGAGTACTCAGCTTATTGGCTACAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)