EMAIL THIS PAGE TO A FRIEND

PIK3R6

phosphoinositide-3-kinase, regulatory subunit 6

60 Gene Product Result for
Synonyms: C17orf38 HsT41028 p84 p84 PIKAP p87(PIKAP) p87PIKAP
UniProtKB ID: Q5UE93, Q658R3
Gene ID:
Human(146850) Summary: Phosphoinositide 3-kinase gamma is a lipid kinase that produces the lipid second messenger phosphatidylinositol 3,4,5-trisphosphate. The kinase is composed of a catalytic subunit and one of several regulatory subunits, and is chiefly activated by G protein-coupled receptors. This gene encodes a regulatory subunit, and is distantly related to the phosphoinositide-3-kinase, regulatory subunit 5 gene which is located adjacent to this gene on chromosome 7. The orthologous protein in the mouse binds to both the catalytic subunit and to G(beta/gamma), and mediates activation of the kinase subunit downstream of G protein-coupled receptors. [provided by RefSeq, Jul 2008]
Mouse(104709) phosphoinositide-3-kinase, regulatory subunit 6
Rat(497932) phosphoinositide-3-kinase, regulatory subunit 6
chicken(769202) phosphoinositide-3-kinase, regulatory subunit 6
Horse(100062779) phosphoinositide-3-kinase, regulatory subunit 6
domestic cat(101082104) phosphoinositide-3-kinase, regulatory subunit 6
dog(608225) phosphoinositide-3-kinase, regulatory subunit 6
domestic guinea pig(100729521) phosphoinositide-3-kinase, regulatory subunit 6
Domestic Rabbit(100340526) phosphoinositide-3-kinase, regulatory subunit 6
naked mole-rat(101721410) phosphoinositide-3-kinase, regulatory subunit 6
cow(515621) phosphoinositide-3-kinase, regulatory subunit 6
sheep(101109720) phosphoinositide-3-kinase, regulatory subunit 6
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001004435 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001004435 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001004435 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001010855 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001010855 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001010855 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001010855 Rosetta Predictions human pricing
NM_001081444 Rosetta Predictions rat pricing
NM_001004435 Rosetta Predictions mouse pricing
NM_001081566 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001010855 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00305794 predicted 1925
2 SASI_Hs01_00168212 predicted 666
3 SASI_Hs01_00168214 predicted 1909
4 SASI_Hs01_00168219 predicted 693
5 SASI_Hs01_00168221 predicted 2252
6 SASI_Hs02_00305795 predicted 2106
7 SASI_Hs02_00305796 predicted 1482
8 SASI_Hs02_00305797 predicted 1828
9 SASI_Hs02_00305798 predicted 2402
10 SASI_Hs02_00305799 predicted 503
11 SASI_Hs01_00168213 predicted 1245
12 SASI_Hs01_00168215 predicted 1759
13 SASI_Hs01_00168216 predicted 2009
14 SASI_Hs01_00168217 predicted 1464
15 SASI_Hs01_00168218 predicted 1589
16 SASI_Hs01_00168220 predicted 1953
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081444 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00208589 predicted 1645
2 SASI_Rn02_00208590 predicted 1290
3 SASI_Rn02_00208591 predicted 1760
4 SASI_Rn02_00208592 predicted 283
5 SASI_Rn02_00208593 predicted 1620
6 SASI_Rn02_00208594 predicted 1434
7 SASI_Rn02_00208595 predicted 1449
8 SASI_Rn02_00208596 predicted 264
9 SASI_Rn02_00208597 predicted 1467
10 SASI_Rn02_00208598 predicted 752
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004435 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00286546 predicted 2547
2 SASI_Mm01_00187827 predicted 2275
3 SASI_Mm01_00187828 predicted 790
4 SASI_Mm01_00187829 predicted 2325
5 SASI_Mm02_00286547 predicted 720
6 SASI_Mm01_00187830 predicted 2524
7 SASI_Mm01_00187831 predicted 597
8 SASI_Mm01_00187833 predicted 2498
9 SASI_Mm01_00187834 predicted 2548
10 SASI_Mm01_00187835 predicted 457
11 SASI_Mm01_00187826 predicted 365
12 SASI_Mm01_00187832 predicted 1701
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081566 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00298700 predicted 2551
2 SASI_Mm02_00298701 predicted 2284
3 SASI_Mm02_00298702 predicted 792
4 SASI_Mm02_00298703 predicted 2339
5 SASI_Mm02_00298704 predicted 720
6 SASI_Mm02_00298705 predicted 2533
7 SASI_Mm02_00298706 predicted 602
8 SASI_Mm02_00298707 predicted 2504
9 SASI_Mm02_00298708 predicted 2569
10 SASI_Mm02_00298709 predicted 454
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001004435
PIK3R6 MISSION shRNA Bacterial Glycerol Stock
phosphoinositide-3-kinase, regulatory subunit 6
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000109906    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004435.1-1833s1c1
Sequence:CCGGGCCCATCTATTTCCAGCTCTACTCGAGTAGAGCTGGAAATAGATGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109907    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004435.1-1198s1c1
Sequence:CCGGGCCTTGGATCTACAAGGATTTCTCGAGAAATCCTTGTAGATCCAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109909    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004435.1-1794s1c1
Sequence:CCGGCCTGGATGTCATCACTTACTACTCGAGTAGTAAGTGATGACATCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109905    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001004435.1-2542s1c1
Sequence:CCGGCCCAAGAAGGAAGAAACACTACTCGAGTAGTGTTTCTTCCTTCTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109908    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004435.1-661s1c1
Sequence:CCGGGAGCAGAATCTGATAAGTGAACTCGAGTTCACTTATCAGATTCTGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001004435
PIK3R6 MISSION shRNA shRNA Plasmid DNA
phosphoinositide-3-kinase, regulatory subunit 6
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000109906    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004435.1-1833s1c1
Sequence:CCGGGCCCATCTATTTCCAGCTCTACTCGAGTAGAGCTGGAAATAGATGGGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000109907    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004435.1-1198s1c1
Sequence:CCGGGCCTTGGATCTACAAGGATTTCTCGAGAAATCCTTGTAGATCCAAGGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000109909    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004435.1-1794s1c1
Sequence:CCGGCCTGGATGTCATCACTTACTACTCGAGTAGTAAGTGATGACATCCAGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000109905    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001004435.1-2542s1c1
Sequence:CCGGCCCAAGAAGGAAGAAACACTACTCGAGTAGTGTTTCTTCCTTCTTGGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000109908    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004435.1-661s1c1
Sequence:CCGGGAGCAGAATCTGATAAGTGAACTCGAGTTCACTTATCAGATTCTGCTCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001004435
PIK3R6 MISSION shRNA Lentiviral Transduction Particles
phosphoinositide-3-kinase, regulatory subunit 6
Mouse
5 Products Total
TRC Number Volume Titer/mL Vector Price Set Price (5+)? Select
TRCN0000109906    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004435.1-1833s1c1
Sequence:CCGGGCCCATCTATTTCCAGCTCTACTCGAGTAGAGCTGGAAATAGATGGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000109907    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004435.1-1198s1c1
Sequence:CCGGGCCTTGGATCTACAAGGATTTCTCGAGAAATCCTTGTAGATCCAAGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000109909    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004435.1-1794s1c1
Sequence:CCGGCCTGGATGTCATCACTTACTACTCGAGTAGTAAGTGATGACATCCAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000109905    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001004435.1-2542s1c1
Sequence:CCGGCCCAAGAAGGAAGAAACACTACTCGAGTAGTGTTTCTTCCTTCTTGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000109908    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004435.1-661s1c1
Sequence:CCGGGAGCAGAATCTGATAAGTGAACTCGAGTTCACTTATCAGATTCTGCTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001010855
PIK3R6 MISSION shRNA Bacterial Glycerol Stock
phosphoinositide-3-kinase, regulatory subunit 6
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000107184    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010855.1-1685s1c1
Sequence:CCGGAGGTGAAGATCCAAGATTCTACTCGAGTAGAATCTTGGATCTTCACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107182    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010855.1-160s1c1
Sequence:CCGGGTCCGCATTCTTCTCAGAGAACTCGAGTTCTCTGAGAAGAATGCGGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107180    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010855.1-418s1c1
Sequence:CCGGGCCGAACAGAACTTGACGAATCTCGAGATTCGTCAAGTTCTGTTCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107181    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010855.1-1608s1c1
Sequence:CCGGCCAGATCTACACAGTCAAGATCTCGAGATCTTGACTGTGTAGATCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107183    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010855.1-1871s1c1
Sequence:CCGGACACAGAAGTTTCAGGGTCTACTCGAGTAGACCCTGAAACTTCTGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001010855
PIK3R6 MISSION shRNA shRNA Plasmid DNA
phosphoinositide-3-kinase, regulatory subunit 6
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000107184    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010855.1-1685s1c1
Sequence:CCGGAGGTGAAGATCCAAGATTCTACTCGAGTAGAATCTTGGATCTTCACCTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000107182    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010855.1-160s1c1
Sequence:CCGGGTCCGCATTCTTCTCAGAGAACTCGAGTTCTCTGAGAAGAATGCGGACTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000107180    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010855.1-418s1c1
Sequence:CCGGGCCGAACAGAACTTGACGAATCTCGAGATTCGTCAAGTTCTGTTCGGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000107181    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010855.1-1608s1c1
Sequence:CCGGCCAGATCTACACAGTCAAGATCTCGAGATCTTGACTGTGTAGATCTGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000107183    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010855.1-1871s1c1
Sequence:CCGGACACAGAAGTTTCAGGGTCTACTCGAGTAGACCCTGAAACTTCTGTGTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001010855
PIK3R6 MISSION shRNA Lentiviral Transduction Particles
phosphoinositide-3-kinase, regulatory subunit 6
Human
5 Products Total
TRC Number Volume Titer/mL Vector Price Set Price (5+)? Select
TRCN0000107184    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010855.1-1685s1c1
Sequence:CCGGAGGTGAAGATCCAAGATTCTACTCGAGTAGAATCTTGGATCTTCACCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000107182    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010855.1-160s1c1
Sequence:CCGGGTCCGCATTCTTCTCAGAGAACTCGAGTTCTCTGAGAAGAATGCGGACTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000107180    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010855.1-418s1c1
Sequence:CCGGGCCGAACAGAACTTGACGAATCTCGAGATTCGTCAAGTTCTGTTCGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000107181    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010855.1-1608s1c1
Sequence:CCGGCCAGATCTACACAGTCAAGATCTCGAGATCTTGACTGTGTAGATCTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000107183    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010855.1-1871s1c1
Sequence:CCGGACACAGAAGTTTCAGGGTCTACTCGAGTAGACCCTGAAACTTCTGTGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)