EMAIL THIS PAGE TO A FRIEND

PILRA

paired immunoglobin-like type 2 receptor alpha

73 Gene Product Result for
Synonyms: FDF03
UniProtKB ID: Q9UKJ1, Q8NHI1
Gene ID:
Human(29992) Summary: Cell signaling pathways rely on a dynamic interaction between activating and inhibiting processes. SHP-1-mediated dephosphorylation of protein tyrosine residues is central to the regulation of several cell signaling pathways. Two types of inhibitory receptor superfamily members are immunoreceptor tyrosine-based inhibitory motif (ITIM)-bearing receptors and their non-ITIM-bearing, activating counterparts. Control of cell signaling via SHP-1 is thought to occur through a balance between PILRalpha-mediated inhibition and PILRbeta-mediated activation. These paired immunoglobulin-like receptor genes are located in a tandem head-to-tail orientation on chromosome 7. This particular gene encodes the ITIM-bearing member of the receptor pair, which functions in the inhibitory role. Alternative splicing has been observed at this locus and three variants, each encoding a distinct isoform, are described. [provided by RefSeq, Jul 2008]
Mouse(231805) paired immunoglobin-like type 2 receptor alpha
Rat(288568) paired immunoglobin-like type 2 receptor alpha
dog(489841) paired immunoglobin-like type 2 receptor alpha
domestic guinea pig(100715696) paired immunoglobin-like type 2 receptor alpha
naked mole-rat(101721193) paired immunoglobin-like type 2 receptor alpha
cow(100137734) paired immunoglobin-like type 2 receptor alpha
sheep(101122158) paired immunoglobin-like type 2 receptor alpha
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_013439 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_013439 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_013439 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_153510 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_153510 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_153510 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_013439 Rosetta Predictions human pricing
NM_178272 Rosetta Predictions human pricing
NM_178273 Rosetta Predictions human pricing
XM_213732 Rosetta Predictions rat pricing
NM_153510 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013439 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00207041 predicted 390
2 SASI_Hs01_00207042 predicted 399
3 SASI_Hs01_00207043 predicted 386
4 SASI_Hs01_00207044 predicted 399
5 SASI_Hs01_00207045 predicted 981
6 SASI_Hs01_00207046 predicted 711
7 SASI_Hs01_00207047 predicted 934
8 SASI_Hs01_00207048 predicted 1090
9 SASI_Hs01_00207049 predicted 751
10 SASI_Hs01_00207050 predicted 939
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178272 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00058089 predicted 393
2 SASI_Hs01_00058090 predicted 395
3 SASI_Hs01_00058091 predicted 389
4 SASI_Hs01_00058092 predicted 399
5 SASI_Hs01_00058093 predicted 757
6 SASI_Hs01_00058094 predicted 882
7 SASI_Hs01_00058095 predicted 871
8 SASI_Hs01_00058096 predicted 711
9 SASI_Hs01_00058097 predicted 863
10 SASI_Hs01_00058098 predicted 717
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178273 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00216943 predicted 388
2 SASI_Hs01_00216944 predicted 397
3 SASI_Hs01_00216945 predicted 390
4 SASI_Hs01_00216946 predicted 398
5 SASI_Hs01_00216947 predicted 723
6 SASI_Hs01_00216948 predicted 848
7 SASI_Hs01_00216949 predicted 839
8 SASI_Hs01_00216950 predicted 680
9 SASI_Hs01_00216951 predicted 831
10 SASI_Hs01_00216952 predicted 685
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_213732 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00374866 predicted 208
2 SASI_Rn02_00374867 predicted 475
3 SASI_Rn02_00374868 predicted 581
4 SASI_Rn02_00374869 predicted 109
5 SASI_Rn02_00374870 predicted 579
6 SASI_Rn02_00374871 predicted 63
7 SASI_Rn02_00374872 predicted 93
8 SASI_Rn02_00374873 predicted 68
9 SASI_Rn02_00374874 predicted 60
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153510 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00123838 predicted 696
2 SASI_Mm01_00123839 predicted 618
3 SASI_Mm01_00123841 predicted 725
4 SASI_Mm01_00123842 predicted 807
5 SASI_Mm01_00123843 predicted 595
6 SASI_Mm01_00123844 predicted 782
7 SASI_Mm01_00123845 predicted 589
8 SASI_Mm01_00123846 predicted 436
9 SASI_Mm01_00123847 predicted 735
10 SASI_Mm02_00343258 predicted 769
11 SASI_Mm01_00123840 predicted 796
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013439
PILRA MISSION shRNA Bacterial Glycerol Stock
paired immunoglobin-like type 2 receptor alpha
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000373204    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013439.2-1133s21c1
Sequence:CCGGCAGCCCTCTCAAGACTGAATGCTCGAGCATTCAGTCTTGAGAGGGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373201    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013439.2-881s21c1
Sequence:CCGGGAAAGGTCAGCAGCGGACTAACTCGAGTTAGTCCGCTGCTGACCTTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061075    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013439.2-1097s1c1
Sequence:CCGGGACCCTGTACTCTGTCTTAAACTCGAGTTTAAGACAGAGTACAGGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061076    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013439.2-944s1c1
Sequence:CCGGGCCATATGAGAATATCAGGAACTCGAGTTCCTGATATTCTCATATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061077    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013439.2-694s1c1
Sequence:CCGGGCAGCATGACTACCACCTGGACTCGAGTCCAGGTGGTAGTCATGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061073    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013439.2-984s1c1
Sequence:CCGGCCCAAGCTAAATCCCAAGGATCTCGAGATCCTTGGGATTTAGCTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061074    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013439.2-769s1c1
Sequence:CCGGGCTCAGACTCTTGGCACATAACTCGAGTTATGTGCCAAGAGTCTGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373203    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013439.2-399s21c1
Sequence:CCGGACAGCTCCCGACGTGAGAATACTCGAGTATTCTCACGTCGGGAGCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013439
PILRA MISSION shRNA shRNA Plasmid DNA
paired immunoglobin-like type 2 receptor alpha
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000373204    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013439.2-1133s21c1
Sequence:CCGGCAGCCCTCTCAAGACTGAATGCTCGAGCATTCAGTCTTGAGAGGGCTGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000373201    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013439.2-881s21c1
Sequence:CCGGGAAAGGTCAGCAGCGGACTAACTCGAGTTAGTCCGCTGCTGACCTTTCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000061075    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013439.2-1097s1c1
Sequence:CCGGGACCCTGTACTCTGTCTTAAACTCGAGTTTAAGACAGAGTACAGGGTCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000061076    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013439.2-944s1c1
Sequence:CCGGGCCATATGAGAATATCAGGAACTCGAGTTCCTGATATTCTCATATGGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000061077    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013439.2-694s1c1
Sequence:CCGGGCAGCATGACTACCACCTGGACTCGAGTCCAGGTGGTAGTCATGCTGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000061073    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013439.2-984s1c1
Sequence:CCGGCCCAAGCTAAATCCCAAGGATCTCGAGATCCTTGGGATTTAGCTTGGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000061074    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013439.2-769s1c1
Sequence:CCGGGCTCAGACTCTTGGCACATAACTCGAGTTATGTGCCAAGAGTCTGAGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000373203    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013439.2-399s21c1
Sequence:CCGGACAGCTCCCGACGTGAGAATACTCGAGTATTCTCACGTCGGGAGCTGTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013439
PILRA MISSION shRNA Lentiviral Transduction Particles
paired immunoglobin-like type 2 receptor alpha
Human
8 Products Total
TRC Number Volume Titer/mL Vector Price Set Price (5+)? Select
TRCN0000373204    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013439.2-1133s21c1
Sequence:CCGGCAGCCCTCTCAAGACTGAATGCTCGAGCATTCAGTCTTGAGAGGGCTGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000373201    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013439.2-881s21c1
Sequence:CCGGGAAAGGTCAGCAGCGGACTAACTCGAGTTAGTCCGCTGCTGACCTTTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061075    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013439.2-1097s1c1
Sequence:CCGGGACCCTGTACTCTGTCTTAAACTCGAGTTTAAGACAGAGTACAGGGTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061076    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013439.2-944s1c1
Sequence:CCGGGCCATATGAGAATATCAGGAACTCGAGTTCCTGATATTCTCATATGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061077    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013439.2-694s1c1
Sequence:CCGGGCAGCATGACTACCACCTGGACTCGAGTCCAGGTGGTAGTCATGCTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061073    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013439.2-984s1c1
Sequence:CCGGCCCAAGCTAAATCCCAAGGATCTCGAGATCCTTGGGATTTAGCTTGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061074    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013439.2-769s1c1
Sequence:CCGGGCTCAGACTCTTGGCACATAACTCGAGTTATGTGCCAAGAGTCTGAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000373203    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013439.2-399s21c1
Sequence:CCGGACAGCTCCCGACGTGAGAATACTCGAGTATTCTCACGTCGGGAGCTGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153510
PILRA MISSION shRNA Bacterial Glycerol Stock
paired immunoglobin-like type 2 receptor alpha
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000099748    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153510.1-601s1c1
Sequence:CCGGGAAGTCAAGAGTGCTAACATTCTCGAGAATGTTAGCACTCTTGACTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099745    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153510.1-837s1c1
Sequence:CCGGCAAGGATAATAACATCGTGTACTCGAGTACACGATGTTATTATCCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099749    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153510.1-766s1c1
Sequence:CCGGCCATTGGAAACCAGTGAGAAACTCGAGTTTCTCACTGGTTTCCAATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099747    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153510.1-508s1c1
Sequence:CCGGACCCAACTCAATGTGACCAATCTCGAGATTGGTCACATTGAGTTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099746    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153510.1-600s1c1
Sequence:CCGGAGAAGTCAAGAGTGCTAACATCTCGAGATGTTAGCACTCTTGACTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153510
PILRA MISSION shRNA shRNA Plasmid DNA
paired immunoglobin-like type 2 receptor alpha
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000099748    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153510.1-601s1c1
Sequence:CCGGGAAGTCAAGAGTGCTAACATTCTCGAGAATGTTAGCACTCTTGACTTCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000099745    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153510.1-837s1c1
Sequence:CCGGCAAGGATAATAACATCGTGTACTCGAGTACACGATGTTATTATCCTTGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000099749    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153510.1-766s1c1
Sequence:CCGGCCATTGGAAACCAGTGAGAAACTCGAGTTTCTCACTGGTTTCCAATGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000099747    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153510.1-508s1c1
Sequence:CCGGACCCAACTCAATGTGACCAATCTCGAGATTGGTCACATTGAGTTGGGTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000099746    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153510.1-600s1c1
Sequence:CCGGAGAAGTCAAGAGTGCTAACATCTCGAGATGTTAGCACTCTTGACTTCTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153510
PILRA MISSION shRNA Lentiviral Transduction Particles
paired immunoglobin-like type 2 receptor alpha
Mouse
5 Products Total
TRC Number Volume Titer/mL Vector Price Set Price (5+)? Select
TRCN0000099748    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153510.1-601s1c1
Sequence:CCGGGAAGTCAAGAGTGCTAACATTCTCGAGAATGTTAGCACTCTTGACTTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000099745    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153510.1-837s1c1
Sequence:CCGGCAAGGATAATAACATCGTGTACTCGAGTACACGATGTTATTATCCTTGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000099749    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153510.1-766s1c1
Sequence:CCGGCCATTGGAAACCAGTGAGAAACTCGAGTTTCTCACTGGTTTCCAATGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000099747    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153510.1-508s1c1
Sequence:CCGGACCCAACTCAATGTGACCAATCTCGAGATTGGTCACATTGAGTTGGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000099746    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153510.1-600s1c1
Sequence:CCGGAGAAGTCAAGAGTGCTAACATCTCGAGATGTTAGCACTCTTGACTTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)