EMAIL THIS PAGE TO A FRIEND

PILRB

paired immunoglobin-like type 2 receptor beta

158 Gene Product Result for
Synonyms: FDFACT1 FDFACT2
Species: Human PILRB(29990), domestic guinea pig Pilrb(100715981)
UniProtKB ID: Q9UKJ0, Q69YF9, Q9HBS0
Gene ID:
Human(29990) Summary: The paired immunoglobin-like type 2 receptors consist of highly related activating and inhibitory receptors that are involved in the regulation of many aspects of the immune system. The paired immunoglobulin-like receptor genes are located in a tandem head-to-tail orientation on chromosome 7. This gene encodes the activating member of the receptor pair and contains a truncated cytoplasmic tail relative to its inhibitory counterpart (PILRA), that has a long cytoplasmic tail with immunoreceptor tyrosine-based inhibitory (ITIM) motifs. This gene is thought to have arisen from a duplication of the inhibitory PILRA gene and evolved to acquire its activating function. [provided by RefSeq, Jun 2013]
domestic guinea pig(100715981) paired immunoglobin-like type 2 receptor beta
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_013440 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_013440 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_013440 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_013440 Rosetta Predictions human pricing
NM_175047 Rosetta Predictions human pricing
NM_178238 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013440 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00108925 predicted 3002
2 SASI_Hs01_00108926 predicted 2992
3 SASI_Hs01_00108927 predicted 2968
4 SASI_Hs01_00108928 predicted 2986
5 SASI_Hs01_00108929 predicted 3022
6 SASI_Hs01_00108930 predicted 3001
7 SASI_Hs01_00108932 predicted 2994
8 SASI_Hs01_00108934 predicted 3556
9 SASI_Hs02_00344842 predicted 3162
10 SASI_Hs02_00344843 predicted 3061
11 SASI_Hs01_00108931 predicted 3033
12 SASI_Hs01_00108933 predicted 3026
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175047 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00103247 predicted 2319
2 SASI_Hs01_00103248 predicted 2318
3 SASI_Hs01_00103249 predicted 2289
4 SASI_Hs01_00103250 predicted 2312
5 SASI_Hs01_00103251 predicted 2348
6 SASI_Hs01_00103252 predicted 2322
7 SASI_Hs01_00103254 predicted 2323
8 SASI_Hs01_00103256 predicted 2888
9 SASI_Hs02_00368941 predicted 2486
10 SASI_Hs02_00368942 predicted 2383
11 SASI_Hs01_00103253 predicted 2356
12 SASI_Hs01_00103255 predicted 2352
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178238 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00062512 predicted 806
2 SASI_Hs01_00062513 predicted 801
3 SASI_Hs01_00062514 predicted 775
4 SASI_Hs01_00062515 predicted 796
5 SASI_Hs01_00062516 predicted 827
6 SASI_Hs01_00062517 predicted 798
7 SASI_Hs01_00062519 predicted 801
8 SASI_Hs01_00062521 predicted 483
9 SASI_Hs02_00369621 predicted 1364
10 SASI_Hs02_00369622 predicted 963
11 SASI_Hs01_00062518 predicted 835
12 SASI_Hs01_00062520 predicted 839
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013440
VALIDATED
PILRB MISSION shRNA Bacterial Glycerol Stock
paired immunoglobin-like type 2 receptor beta
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000296906    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013440.3-3391s21c1
Sequence:CCGGGCATCCACACTGCAATGATATCTCGAGATATCATTGCAGTGTGGATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291329    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013440.3-2681s21c1
Sequence:CCGGCCATAGTTCCCAACGTGAGAACTCGAGTTCTCACGTTGGGAACTATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060993    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_013440.3-3029s1c1
Sequence:CCGGACTCAGAATCATGGCACCTAACTCGAGTTAGGTGCCATGATTCTGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060994    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_013440.3-2753s1c1
Sequence:CCGGCGCCTTCCATTCACAAGGATTCTCGAGAATCCTTGTGAATGGAAGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060995    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013440.3-2681s1c1
Sequence:CCGGCCATAGTTCCCAACGTGAGAACTCGAGTTCTCACGTTGGGAACTATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060997    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_013440.3-3057s1c1
Sequence:CCGGCACTGCCATCAGGGTTGCATTCTCGAGAATGCAACCCTGATGGCAGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013440.3-2817s1c1
Sequence:CCGGCGGCTTCCTCAGGATCTCAAACTCGAGTTTGAGATCCTGAGGAAGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331166    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013440.3-2904s21c1
Sequence:CCGGGCAGCAGTTGCAGTCCATCAACTCGAGTTGATGGACTGCAACTGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291327    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013440.3-2817s21c1
Sequence:CCGGCGGCTTCCTCAGGATCTCAAACTCGAGTTTGAGATCCTGAGGAAGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291328    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013440.3-2753s21c1
Sequence:CCGGCGCCTTCCATTCACAAGGATTCTCGAGAATCCTTGTGAATGGAAGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013440
VALIDATED
PILRB MISSION shRNA shRNA Plasmid DNA
paired immunoglobin-like type 2 receptor beta
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000296906    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013440.3-3391s21c1
Sequence:CCGGGCATCCACACTGCAATGATATCTCGAGATATCATTGCAGTGTGGATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000291329    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013440.3-2681s21c1
Sequence:CCGGCCATAGTTCCCAACGTGAGAACTCGAGTTCTCACGTTGGGAACTATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060993    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_013440.3-3029s1c1
Sequence:CCGGACTCAGAATCATGGCACCTAACTCGAGTTAGGTGCCATGATTCTGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060994    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_013440.3-2753s1c1
Sequence:CCGGCGCCTTCCATTCACAAGGATTCTCGAGAATCCTTGTGAATGGAAGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060995    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013440.3-2681s1c1
Sequence:CCGGCCATAGTTCCCAACGTGAGAACTCGAGTTCTCACGTTGGGAACTATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060997    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_013440.3-3057s1c1
Sequence:CCGGCACTGCCATCAGGGTTGCATTCTCGAGAATGCAACCCTGATGGCAGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013440.3-2817s1c1
Sequence:CCGGCGGCTTCCTCAGGATCTCAAACTCGAGTTTGAGATCCTGAGGAAGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000331166    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013440.3-2904s21c1
Sequence:CCGGGCAGCAGTTGCAGTCCATCAACTCGAGTTGATGGACTGCAACTGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000291327    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013440.3-2817s21c1
Sequence:CCGGCGGCTTCCTCAGGATCTCAAACTCGAGTTTGAGATCCTGAGGAAGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000291328    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013440.3-2753s21c1
Sequence:CCGGCGCCTTCCATTCACAAGGATTCTCGAGAATCCTTGTGAATGGAAGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013440
VALIDATED
PILRB MISSION shRNA Lentiviral Transduction Particles
paired immunoglobin-like type 2 receptor beta
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000296906    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013440.3-3391s21c1
Sequence:CCGGGCATCCACACTGCAATGATATCTCGAGATATCATTGCAGTGTGGATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291329    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013440.3-2681s21c1
Sequence:CCGGCCATAGTTCCCAACGTGAGAACTCGAGTTCTCACGTTGGGAACTATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060993    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_013440.3-3029s1c1
Sequence:CCGGACTCAGAATCATGGCACCTAACTCGAGTTAGGTGCCATGATTCTGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060994    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_013440.3-2753s1c1
Sequence:CCGGCGCCTTCCATTCACAAGGATTCTCGAGAATCCTTGTGAATGGAAGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060995    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013440.3-2681s1c1
Sequence:CCGGCCATAGTTCCCAACGTGAGAACTCGAGTTCTCACGTTGGGAACTATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060997    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_013440.3-3057s1c1
Sequence:CCGGCACTGCCATCAGGGTTGCATTCTCGAGAATGCAACCCTGATGGCAGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013440.3-2817s1c1
Sequence:CCGGCGGCTTCCTCAGGATCTCAAACTCGAGTTTGAGATCCTGAGGAAGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331166    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013440.3-2904s21c1
Sequence:CCGGGCAGCAGTTGCAGTCCATCAACTCGAGTTGATGGACTGCAACTGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291327    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013440.3-2817s21c1
Sequence:CCGGCGGCTTCCTCAGGATCTCAAACTCGAGTTTGAGATCCTGAGGAAGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291328    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013440.3-2753s21c1
Sequence:CCGGCGCCTTCCATTCACAAGGATTCTCGAGAATCCTTGTGAATGGAAGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)