EMAIL THIS PAGE TO A FRIEND

PIM1

pim-1 oncogene

77 Gene Product Result for
Synonyms: PIM
UniProtKB ID: P11309, Q38RT9, Q5T7H7, Q96RG3
Gene ID:
Human(5292) Summary: The protein encoded by this gene belongs to the Ser/Thr protein kinase family, and PIM subfamily. This gene is expressed primarily in B-lymphoid and myeloid cell lines, and is overexpressed in hematopoietic malignancies and in prostate cancer. It plays a role in signal transduction in blood cells, contributing to both cell proliferation and survival, and thus provides a selective advantage in tumorigenesis. Both the human and orthologous mouse genes have been reported to encode two isoforms (with preferential cellular localization) resulting from the use of alternative in-frame translation initiation codons, the upstream non-AUG (CUG) and downstream AUG codons (PMIDs:16186805, 1825810).[provided by RefSeq, Aug 2011]
Mouse(18712) proviral integration site 1
Rat(24649) pim-1 oncogene
Zebrafish(58054) pim-1 oncogene
domestic cat(493888) pim-1 oncogene
Horse(100053898) pim-1 oncogene
chicken(100858838) pim-1 oncogene
dog(481772) pim-1 oncogene
cow(281402) pim-1 oncogene
sheep(100272002) pim-1 oncogene
naked mole-rat(101706236) pim-1 oncogene
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1302545 ANTI-MOUSE PIM1 (C-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human, mouse
western blot pricing
SAB4504055 Anti-phospho-Pim-1 (pTyr309) antibody produced in rabbit affinity isolated antibody mouse, rat, human
ELISA, western blot pricing
SAB4301248 Anti-phospho-Pim-1 (pTyr309) antibody produced in rabbit affinity isolated antibody rat, human, mouse
western blot pricing
K0267 Anti-PIM1 (71-84) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
immunofluorescence, western blot pricing
SAB1411965 ANTI-PIM1 antibody produced in mouse clone 1C12, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1411966 ANTI-PIM1 antibody produced in mouse clone 3D12, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing
SAB1411967 ANTI-PIM1 antibody produced in mouse clone 2C9, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1411968 ANTI-PIM1 antibody produced in mouse clone 6A8, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1411969 ANTI-PIM1 antibody produced in mouse clone 1C10, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing
SAB1411970 ANTI-PIM1 antibody produced in mouse clone 6G6, purified immunoglobulin, buffered aqueous solution human
ELISA pricing
SAB1412200 ANTI-PIM1 antibody produced in mouse clone 3F5, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry pricing
HPA003941 Anti-PIM1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
SAB2104457 Anti-PIM1, (N-terminal) antibody produced in rabbit affinity isolated antibody rabbit, mouse, horse, human, bovine, sheep, dog, rat
western blot pricing
SAB2104730 Anti-PIM1, (N-terminal) antibody produced in rabbit affinity isolated antibody human, sheep, dog, mouse, guinea pig, bovine, horse, rat, rabbit
western blot pricing
WH0005292M16 Monoclonal Anti-PIM1 antibody produced in mouse clone 6A2, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry pricing
SAB1404205 Monoclonal Anti-PIM1, (N-terminal) antibody produced in mouse clone 2C8, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing
PLA0088 Rabbit anti-PIM1 Antibody, Affinity Purified Powered by Bethyl Laboratories, Inc. human
immunoprecipitation (IP), proximity ligation assay, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008842 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008842 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008842 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002648 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002648 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002648 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU090851 MISSION® esiRNA esiRNA targeting mouse Pim1 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002648 Rosetta Predictions human pricing
NM_017034 Rosetta Predictions rat pricing
NM_008842 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002648 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00073783 predicted 1057
2 SASI_Hs01_00073785 predicted 955
3 SASI_Hs01_00073786 predicted 615
4 SASI_Hs02_00334182 predicted 514
5 SASI_Hs01_00073787 predicted 1073
6 SASI_Hs01_00073788 predicted 609
7 SASI_Hs01_00073789 predicted 739
8 SASI_Hs01_00073790 predicted 1144
9 SASI_Hs01_00073791 predicted 945
10 SASI_Hs01_00073792 predicted 1081
11 SASI_Hs01_00073784 predicted 978
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017034 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00078455 predicted 699
2 SASI_Rn01_00078456 predicted 751
3 SASI_Rn01_00078458 predicted 258
4 SASI_Rn02_00261214 predicted 612
5 SASI_Rn01_00078459 predicted 332
6 SASI_Rn01_00078460 predicted 708
7 SASI_Rn02_00261215 predicted 305
8 SASI_Rn01_00078461 predicted 587
9 SASI_Rn01_00078462 predicted 777
10 SASI_Rn02_00261216 predicted 311
11 SASI_Rn01_00078457 predicted 765
12 SASI_Rn01_00078463 predicted 730
13 SASI_Rn01_00078464 predicted 534
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008842 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00071553 predicted 790
2 SASI_Mm01_00071554 predicted 470
3 SASI_Mm01_00071555 predicted 846
4 SASI_Mm01_00071556 predicted 392
5 SASI_Mm02_00314781 predicted 270
6 SASI_Mm01_00071557 predicted 1127
7 SASI_Mm01_00071558 predicted 678
8 SASI_Mm01_00071559 predicted 238
9 SASI_Mm01_00071560 predicted 493
10 SASI_Mm01_00071561 predicted 402
11 SASI_Mm01_00071562 predicted 1116
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008842
VALIDATED
PIM1 MISSION shRNA Bacterial Glycerol Stock
pim-1 oncogene
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000361356    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008842.3-798s21c1
Sequence:CCGGTGACATGGTCTGCGGAGATATCTCGAGATATCTCCGCAGACCATGTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322025    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008842.3-476s21c1
Sequence:CCGGTGCAAGACCTCTTCGACTTTACTCGAGTAAAGTCGAAGAGGTCTTGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322087    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008842.3-404s21c1
Sequence:CCGGGCGTCATTAGACTTCTGGACTCTCGAGAGTCCAGAAGTCTAATGACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361357    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008842.3-1507s21c1
Sequence:CCGGCTTACCTGCTGCTTCTCAAACCTCGAGGTTTGAGAAGCAGCAGGTAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322024    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008842.3-882s21c1
Sequence:CCGGAGAGTGTCAGCACCTTATTAACTCGAGTTAATAAGGTGCTGACACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024383    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008842.2-1116s1c1
Sequence:CCGGGAGTGTCAGCACCTTATTAAACTCGAGTTTAATAAGGTGCTGACACTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024380    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008842.2-1068s1c1
Sequence:CCGGGAAGAGATCATCAAGGGCCAACTCGAGTTGGCCCTTGATGATCTCTTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350690    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008842.3-1483s21c1
Sequence:CCGGGGGAGAAATACTTGAACTTTACTCGAGTAAAGTTCAAGTATTTCTCCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024381    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008842.2-869s1c1
Sequence:CCGGCGGCGAAATCAAACTCATCGACTCGAGTCGATGAGTTTGATTTCGCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024382    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008842.2-637s1c1
Sequence:CCGGGCGTCATTAGACTTCTGGACTCTCGAGAGTCCAGAAGTCTAATGACGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024379    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008842.2-668s1c1
Sequence:CCGGGCCCGATAGTTTCGTGCTGATCTCGAGATCAGCACGAAACTATCGGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008842
VALIDATED
PIM1 MISSION shRNA shRNA Plasmid DNA
pim-1 oncogene
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000361356    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008842.3-798s21c1
Sequence:CCGGTGACATGGTCTGCGGAGATATCTCGAGATATCTCCGCAGACCATGTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000322025    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008842.3-476s21c1
Sequence:CCGGTGCAAGACCTCTTCGACTTTACTCGAGTAAAGTCGAAGAGGTCTTGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000322087    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008842.3-404s21c1
Sequence:CCGGGCGTCATTAGACTTCTGGACTCTCGAGAGTCCAGAAGTCTAATGACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000361357    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008842.3-1507s21c1
Sequence:CCGGCTTACCTGCTGCTTCTCAAACCTCGAGGTTTGAGAAGCAGCAGGTAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000322024    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008842.3-882s21c1
Sequence:CCGGAGAGTGTCAGCACCTTATTAACTCGAGTTAATAAGGTGCTGACACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024383    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008842.2-1116s1c1
Sequence:CCGGGAGTGTCAGCACCTTATTAAACTCGAGTTTAATAAGGTGCTGACACTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024380    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008842.2-1068s1c1
Sequence:CCGGGAAGAGATCATCAAGGGCCAACTCGAGTTGGCCCTTGATGATCTCTTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000350690    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008842.3-1483s21c1
Sequence:CCGGGGGAGAAATACTTGAACTTTACTCGAGTAAAGTTCAAGTATTTCTCCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024381    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008842.2-869s1c1
Sequence:CCGGCGGCGAAATCAAACTCATCGACTCGAGTCGATGAGTTTGATTTCGCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024382    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008842.2-637s1c1
Sequence:CCGGGCGTCATTAGACTTCTGGACTCTCGAGAGTCCAGAAGTCTAATGACGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024379    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008842.2-668s1c1
Sequence:CCGGGCCCGATAGTTTCGTGCTGATCTCGAGATCAGCACGAAACTATCGGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008842
VALIDATED
PIM1 MISSION shRNA Lentiviral Transduction Particles
pim-1 oncogene
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000361356    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008842.3-798s21c1
Sequence:CCGGTGACATGGTCTGCGGAGATATCTCGAGATATCTCCGCAGACCATGTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322025    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008842.3-476s21c1
Sequence:CCGGTGCAAGACCTCTTCGACTTTACTCGAGTAAAGTCGAAGAGGTCTTGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322087    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008842.3-404s21c1
Sequence:CCGGGCGTCATTAGACTTCTGGACTCTCGAGAGTCCAGAAGTCTAATGACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361357    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008842.3-1507s21c1
Sequence:CCGGCTTACCTGCTGCTTCTCAAACCTCGAGGTTTGAGAAGCAGCAGGTAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322024    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008842.3-882s21c1
Sequence:CCGGAGAGTGTCAGCACCTTATTAACTCGAGTTAATAAGGTGCTGACACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024383    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008842.2-1116s1c1
Sequence:CCGGGAGTGTCAGCACCTTATTAAACTCGAGTTTAATAAGGTGCTGACACTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024380    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008842.2-1068s1c1
Sequence:CCGGGAAGAGATCATCAAGGGCCAACTCGAGTTGGCCCTTGATGATCTCTTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350690    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008842.3-1483s21c1
Sequence:CCGGGGGAGAAATACTTGAACTTTACTCGAGTAAAGTTCAAGTATTTCTCCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024381    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008842.2-869s1c1
Sequence:CCGGCGGCGAAATCAAACTCATCGACTCGAGTCGATGAGTTTGATTTCGCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024382    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008842.2-637s1c1
Sequence:CCGGGCGTCATTAGACTTCTGGACTCTCGAGAGTCCAGAAGTCTAATGACGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024379    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008842.2-668s1c1
Sequence:CCGGGCCCGATAGTTTCGTGCTGATCTCGAGATCAGCACGAAACTATCGGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002648
VALIDATED
PIM1 MISSION shRNA Bacterial Glycerol Stock
pim-1 oncogene
Human
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000320520    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002648.3-1032s21c1
Sequence:CCGGTCGATGGGACCCGAGTGTATACTCGAGTATACACTCGGGTCCCATCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320586    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002648.3-595s21c1
Sequence:CCGGCATCCGCGTCTCCGACAACTTCTCGAGAAGTTGTCGGAGACGCGGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197188    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002648.2-1155s1c1
Sequence:CCGGGCATCTCATTAGATGGTGCTTCTCGAGAAGCACCATCTAATGAGATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199011    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_002648.2-528s1c1
Sequence:CCGGCATCCGCGTCTCCGACAACTTCTCGAGAAGTTGTCGGAGACGCGGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199029    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_002648.2-2250s1c1
Sequence:CCGGCCATAGCTGCTGCCCTAGTTTCTCGAGAAACTAGGGCAGCAGCTATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199712    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002648.2-739s1c1
Sequence:CCGGGTGCAAGATCTCTTCGACTTCCTCGAGGAAGTCGAAGAGATCTTGCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196869    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_002648.2-1530s1c1
Sequence:CCGGGATACTCTCTTCTTCTCATAGCTCGAGCTATGAGAAGAAGAGAGTATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320587    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002648.3-945s21c1
Sequence:CCGGACATCCTTATCGACCTCAATCCTCGAGGATTGAGGTCGATAAGGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320518    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002648.3-1273s21c1
Sequence:CCGGCGAAGAAATCCAGAACCATCCCTCGAGGGATGGTTCTGGATTTCTTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010118    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_002648.x-865s1c1
Sequence:CCGGACATCCTTATCGACCTCAATCCTCGAGGATTGAGGTCGATAAGGATGTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010115    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_002648.x-1193s1c1
Sequence:CCGGCGAAGAAATCCAGAACCATCCCTCGAGGGATGGTTCTGGATTTCTTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010117    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_002648.x-644s1c1
Sequence:CCGGGGGTTTCTCCGGCGTCATTAGCTCGAGCTAATGACGCCGGAGAAACCCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010116    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002648.x-553s1c1
Sequence:CCGGACGTGGAGAAGGACCGGATTTCTCGAGAAATCCGGTCCTTCTCCACGTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010119    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002648.x-940s1c1
Sequence:CCGGTCTACACGGACTTCGATGGGACTCGAGTCCCATCGAAGTCCGTGTAGATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320519    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002648.3-2317s21c1
Sequence:CCGGCCATAGCTGCTGCCCTAGTTTCTCGAGAAACTAGGGCAGCAGCTATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002648
VALIDATED
PIM1 MISSION shRNA shRNA Plasmid DNA
pim-1 oncogene
Human
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000320520    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002648.3-1032s21c1
Sequence:CCGGTCGATGGGACCCGAGTGTATACTCGAGTATACACTCGGGTCCCATCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000320586    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002648.3-595s21c1
Sequence:CCGGCATCCGCGTCTCCGACAACTTCTCGAGAAGTTGTCGGAGACGCGGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000197188    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002648.2-1155s1c1
Sequence:CCGGGCATCTCATTAGATGGTGCTTCTCGAGAAGCACCATCTAATGAGATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199011    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_002648.2-528s1c1
Sequence:CCGGCATCCGCGTCTCCGACAACTTCTCGAGAAGTTGTCGGAGACGCGGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199029    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_002648.2-2250s1c1
Sequence:CCGGCCATAGCTGCTGCCCTAGTTTCTCGAGAAACTAGGGCAGCAGCTATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199712    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002648.2-739s1c1
Sequence:CCGGGTGCAAGATCTCTTCGACTTCCTCGAGGAAGTCGAAGAGATCTTGCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196869    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_002648.2-1530s1c1
Sequence:CCGGGATACTCTCTTCTTCTCATAGCTCGAGCTATGAGAAGAAGAGAGTATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000320587    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002648.3-945s21c1
Sequence:CCGGACATCCTTATCGACCTCAATCCTCGAGGATTGAGGTCGATAAGGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000320518    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002648.3-1273s21c1
Sequence:CCGGCGAAGAAATCCAGAACCATCCCTCGAGGGATGGTTCTGGATTTCTTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010118    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_002648.x-865s1c1
Sequence:CCGGACATCCTTATCGACCTCAATCCTCGAGGATTGAGGTCGATAAGGATGTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010115    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_002648.x-1193s1c1
Sequence:CCGGCGAAGAAATCCAGAACCATCCCTCGAGGGATGGTTCTGGATTTCTTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010117    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_002648.x-644s1c1
Sequence:CCGGGGGTTTCTCCGGCGTCATTAGCTCGAGCTAATGACGCCGGAGAAACCCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010116    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002648.x-553s1c1
Sequence:CCGGACGTGGAGAAGGACCGGATTTCTCGAGAAATCCGGTCCTTCTCCACGTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010119    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002648.x-940s1c1
Sequence:CCGGTCTACACGGACTTCGATGGGACTCGAGTCCCATCGAAGTCCGTGTAGATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000320519    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002648.3-2317s21c1
Sequence:CCGGCCATAGCTGCTGCCCTAGTTTCTCGAGAAACTAGGGCAGCAGCTATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002648
VALIDATED
PIM1 MISSION shRNA Lentiviral Transduction Particles
pim-1 oncogene
Human
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000320520    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002648.3-1032s21c1
Sequence:CCGGTCGATGGGACCCGAGTGTATACTCGAGTATACACTCGGGTCCCATCGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320586    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002648.3-595s21c1
Sequence:CCGGCATCCGCGTCTCCGACAACTTCTCGAGAAGTTGTCGGAGACGCGGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197188    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002648.2-1155s1c1
Sequence:CCGGGCATCTCATTAGATGGTGCTTCTCGAGAAGCACCATCTAATGAGATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199011    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_002648.2-528s1c1
Sequence:CCGGCATCCGCGTCTCCGACAACTTCTCGAGAAGTTGTCGGAGACGCGGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199029    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_002648.2-2250s1c1
Sequence:CCGGCCATAGCTGCTGCCCTAGTTTCTCGAGAAACTAGGGCAGCAGCTATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199712    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002648.2-739s1c1
Sequence:CCGGGTGCAAGATCTCTTCGACTTCCTCGAGGAAGTCGAAGAGATCTTGCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196869    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_002648.2-1530s1c1
Sequence:CCGGGATACTCTCTTCTTCTCATAGCTCGAGCTATGAGAAGAAGAGAGTATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320587    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002648.3-945s21c1
Sequence:CCGGACATCCTTATCGACCTCAATCCTCGAGGATTGAGGTCGATAAGGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320518    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002648.3-1273s21c1
Sequence:CCGGCGAAGAAATCCAGAACCATCCCTCGAGGGATGGTTCTGGATTTCTTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010118    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_002648.x-865s1c1
Sequence:CCGGACATCCTTATCGACCTCAATCCTCGAGGATTGAGGTCGATAAGGATGTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010115    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_002648.x-1193s1c1
Sequence:CCGGCGAAGAAATCCAGAACCATCCCTCGAGGGATGGTTCTGGATTTCTTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010117    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_002648.x-644s1c1
Sequence:CCGGGGGTTTCTCCGGCGTCATTAGCTCGAGCTAATGACGCCGGAGAAACCCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010116    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002648.x-553s1c1
Sequence:CCGGACGTGGAGAAGGACCGGATTTCTCGAGAAATCCGGTCCTTCTCCACGTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010119    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002648.x-940s1c1
Sequence:CCGGTCTACACGGACTTCGATGGGACTCGAGTCCCATCGAAGTCCGTGTAGATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320519    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002648.3-2317s21c1
Sequence:CCGGCCATAGCTGCTGCCCTAGTTTCTCGAGAAACTAGGGCAGCAGCTATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)