EMAIL THIS PAGE TO A FRIEND

PIM2

pim-2 oncogene

140 Gene Product Result for
UniProtKB ID: Q9P1W9, A8K4G6, Q99739
Gene ID:
Human(11040) Summary: This gene encodes a protooncogene that acts as a serine/threonine protein kinase. Studies determined the encoded protein functions to prevent apoptosis and to promote cell survival.[provided by RefSeq, Nov 2009]
Mouse(18715) proviral integration site 2
Rat(317366) pim-2 oncogene
cow(508424) pim-2 oncogene
sheep(101107167) pim-2 oncogene
naked mole-rat(101712508) pim-2 oncogene
dog(442959) pim-2 oncogene
domestic cat(101098037) pim-2 oncogene
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_138606 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_138606 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_138606 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006875 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006875 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006875 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006875 siRNAs that have been validated in the lab human pricing
XM_228778 Rosetta Predictions rat pricing
NM_138606 Rosetta Predictions mouse pricing
NM_145736 Rosetta Predictions mouse pricing
NM_145737 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006875 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00136715 validated 642
2 SASI_Hs01_00136716 predicted 754
3 SASI_Hs01_00136717 predicted 532
4 SASI_Hs01_00136719 predicted 405
5 SASI_Hs01_00136720 predicted 786
6 SASI_Hs01_00136721 predicted 228
7 SASI_Hs01_00136722 predicted 499
8 SASI_Hs01_00136723 predicted 697
9 SASI_Hs02_00342522 predicted 615
10 SASI_Hs02_00342523 predicted 247
11 SASI_Hs01_00136714 predicted 532
12 SASI_Hs01_00136718 predicted 468
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_228778 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00149707 predicted 1606
2 SASI_Rn01_00149708 predicted 1721
3 SASI_Rn01_00149709 predicted 1523
4 SASI_Rn01_00149710 predicted 1478
5 SASI_Rn01_00149711 predicted 1351
6 SASI_Rn01_00149712 predicted 1457
7 SASI_Rn01_00149713 predicted 1474
8 SASI_Rn01_00149714 predicted 1694
9 SASI_Rn01_00149715 predicted 1513
10 SASI_Rn01_00149716 predicted 1690
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138606 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00182066 predicted 1188
2 SASI_Mm01_00182067 predicted 1181
3 SASI_Mm01_00182069 predicted 473
4 SASI_Mm02_00339680 predicted 1178
5 SASI_Mm01_00182070 predicted 1216
6 SASI_Mm01_00182071 predicted 713
7 SASI_Mm01_00182072 predicted 714
8 SASI_Mm01_00182073 predicted 791
9 SASI_Mm01_00182074 predicted 1402
10 SASI_Mm02_00339681 predicted 1186
11 SASI_Mm01_00182068 predicted 1174
12 SASI_Mm01_00182075 predicted 270
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145736 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00068405 predicted 1193
2 SASI_Mm01_00068406 predicted 1183
3 SASI_Mm01_00068407 predicted 1182
4 SASI_Mm01_00068408 predicted 485
5 SASI_Mm01_00068409 predicted 1222
6 SASI_Mm01_00068410 predicted 722
7 SASI_Mm01_00068411 predicted 714
8 SASI_Mm01_00068412 predicted 788
9 SASI_Mm01_00068413 predicted 1406
10 SASI_Mm01_00068414 predicted 272
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145737 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00088793 predicted 1189
2 SASI_Mm01_00088794 predicted 1183
3 SASI_Mm01_00088795 predicted 1184
4 SASI_Mm01_00088796 predicted 482
5 SASI_Mm01_00088797 predicted 1221
6 SASI_Mm01_00088798 predicted 724
7 SASI_Mm01_00088799 predicted 713
8 SASI_Mm01_00088800 predicted 795
9 SASI_Mm01_00088801 predicted 1409
10 SASI_Mm01_00088802 predicted 266
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138606
VALIDATED
PIM2 MISSION shRNA Bacterial Glycerol Stock
pim-2 oncogene
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000024154    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138606.1-492s1c1
Sequence:CCGGGCCTTCTTGACTGGTTCGAAACTCGAGTTTCGAACCAGTCAAGAAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024157    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_138606.1-263s1c1
Sequence:CCGGCGGGCAGCTTTCGAGGCCGAACTCGAGTTCGGCCTCGAAAGCTGCCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024158    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_138606.1-913s1c1
Sequence:CCGGCCAGGAGATTCTGGAGGCTGACTCGAGTCAGCCTCCAGAATCTCCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024156    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_138606.1-479s1c1
Sequence:CCGGCCGGGTGTGATACGCCTTCTTCTCGAGAAGAAGGCGTATCACACCCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024155    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_138606.1-162s1c1
Sequence:CCGGGCGGGCTCAATATACGCAGCACTCGAGTGCTGCGTATATTGAGCCCGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353200    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138606.2-913s21c1
Sequence:CCGGCCAGGAGATTCTGGAGGCTGACTCGAGTCAGCCTCCAGAATCTCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280496    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138606.2-492s21c1
Sequence:CCGGGCCTTCTTGACTGGTTCGAAACTCGAGTTTCGAACCAGTCAAGAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280557    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138606.2-479s21c1
Sequence:CCGGCCGGGTGTGATACGCCTTCTTCTCGAGAAGAAGGCGTATCACACCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280556    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138606.2-162s21c1
Sequence:CCGGGCGGGCTCAATATACGCAGCACTCGAGTGCTGCGTATATTGAGCCCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138606
VALIDATED
PIM2 MISSION shRNA shRNA Plasmid DNA
pim-2 oncogene
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000024154    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138606.1-492s1c1
Sequence:CCGGGCCTTCTTGACTGGTTCGAAACTCGAGTTTCGAACCAGTCAAGAAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024157    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_138606.1-263s1c1
Sequence:CCGGCGGGCAGCTTTCGAGGCCGAACTCGAGTTCGGCCTCGAAAGCTGCCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024158    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_138606.1-913s1c1
Sequence:CCGGCCAGGAGATTCTGGAGGCTGACTCGAGTCAGCCTCCAGAATCTCCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024156    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_138606.1-479s1c1
Sequence:CCGGCCGGGTGTGATACGCCTTCTTCTCGAGAAGAAGGCGTATCACACCCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024155    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_138606.1-162s1c1
Sequence:CCGGGCGGGCTCAATATACGCAGCACTCGAGTGCTGCGTATATTGAGCCCGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000353200    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138606.2-913s21c1
Sequence:CCGGCCAGGAGATTCTGGAGGCTGACTCGAGTCAGCCTCCAGAATCTCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000280496    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138606.2-492s21c1
Sequence:CCGGGCCTTCTTGACTGGTTCGAAACTCGAGTTTCGAACCAGTCAAGAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000280557    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138606.2-479s21c1
Sequence:CCGGCCGGGTGTGATACGCCTTCTTCTCGAGAAGAAGGCGTATCACACCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000280556    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138606.2-162s21c1
Sequence:CCGGGCGGGCTCAATATACGCAGCACTCGAGTGCTGCGTATATTGAGCCCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138606
VALIDATED
PIM2 MISSION shRNA Lentiviral Transduction Particles
pim-2 oncogene
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000024154    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138606.1-492s1c1
Sequence:CCGGGCCTTCTTGACTGGTTCGAAACTCGAGTTTCGAACCAGTCAAGAAGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024157    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_138606.1-263s1c1
Sequence:CCGGCGGGCAGCTTTCGAGGCCGAACTCGAGTTCGGCCTCGAAAGCTGCCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024158    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_138606.1-913s1c1
Sequence:CCGGCCAGGAGATTCTGGAGGCTGACTCGAGTCAGCCTCCAGAATCTCCTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024156    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_138606.1-479s1c1
Sequence:CCGGCCGGGTGTGATACGCCTTCTTCTCGAGAAGAAGGCGTATCACACCCGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024155    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_138606.1-162s1c1
Sequence:CCGGGCGGGCTCAATATACGCAGCACTCGAGTGCTGCGTATATTGAGCCCGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353200    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138606.2-913s21c1
Sequence:CCGGCCAGGAGATTCTGGAGGCTGACTCGAGTCAGCCTCCAGAATCTCCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280496    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138606.2-492s21c1
Sequence:CCGGGCCTTCTTGACTGGTTCGAAACTCGAGTTTCGAACCAGTCAAGAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280557    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138606.2-479s21c1
Sequence:CCGGCCGGGTGTGATACGCCTTCTTCTCGAGAAGAAGGCGTATCACACCCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280556    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138606.2-162s21c1
Sequence:CCGGGCGGGCTCAATATACGCAGCACTCGAGTGCTGCGTATATTGAGCCCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006875
VALIDATED
PIM2 MISSION shRNA Bacterial Glycerol Stock
pim-2 oncogene
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000001627    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: A3
TRC Version: 1 Clone ID:NM_006875.x-1226s1c1
Sequence:CCGGCCAGTCATTAAAGTCCAGTATCTCGAGATACTGGACTTTAATGACTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001628    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A3
TRC Version: 1 Clone ID:NM_006875.x-549s1c1
Sequence:CCGGGCCCAGGATCTCTTTGACTATCTCGAGATAGTCAAAGAGATCCTGGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001630    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A3
TRC Version: 1 Clone ID:NM_006875.x-551s1c1
Sequence:CCGGCCAGGATCTCTTTGACTATATCTCGAGATATAGTCAAAGAGATCCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001631    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A3
TRC Version: 1 Clone ID:NM_006875.x-491s1c1
Sequence:CCGGGCTTGACTGGTTTGAGACACACTCGAGTGTGTCTCAAACCAGTCAAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001629    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A3
TRC Version: 1 Clone ID:NM_006875.x-756s1c1
Sequence:CCGGGATGAACCCTACACTGACTTTCTCGAGAAAGTCAGTGTAGGGTTCATCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200008    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006875.2-336s1c1
Sequence:CCGGCGACTCCAGGTGGCCATCAAACTCGAGTTTGATGGCCACCTGGAGTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194699    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_006875.2-1473s1c1
Sequence:CCGGCCACACAAACTTAGTTCATATCTCGAGATATGAACTAAGTTTGTGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199081    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_006875.2-1693s1c1
Sequence:CCGGCCCTACTCTGTTATCCCAAGTCTCGAGACTTGGGATAACAGAGTAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219888    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006875.2-701s1c1
Sequence:CCGGCTGTGCCAAACTCATTGATTTCTCGAGAAATCAATGAGTTTGGCACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006875
VALIDATED
PIM2 MISSION shRNA shRNA Plasmid DNA
pim-2 oncogene
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000001627    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: A3
TRC Version: 1 Clone ID:NM_006875.x-1226s1c1
Sequence:CCGGCCAGTCATTAAAGTCCAGTATCTCGAGATACTGGACTTTAATGACTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001628    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A3
TRC Version: 1 Clone ID:NM_006875.x-549s1c1
Sequence:CCGGGCCCAGGATCTCTTTGACTATCTCGAGATAGTCAAAGAGATCCTGGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001630    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A3
TRC Version: 1 Clone ID:NM_006875.x-551s1c1
Sequence:CCGGCCAGGATCTCTTTGACTATATCTCGAGATATAGTCAAAGAGATCCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001631    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A3
TRC Version: 1 Clone ID:NM_006875.x-491s1c1
Sequence:CCGGGCTTGACTGGTTTGAGACACACTCGAGTGTGTCTCAAACCAGTCAAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001629    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A3
TRC Version: 1 Clone ID:NM_006875.x-756s1c1
Sequence:CCGGGATGAACCCTACACTGACTTTCTCGAGAAAGTCAGTGTAGGGTTCATCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000200008    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006875.2-336s1c1
Sequence:CCGGCGACTCCAGGTGGCCATCAAACTCGAGTTTGATGGCCACCTGGAGTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194699    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_006875.2-1473s1c1
Sequence:CCGGCCACACAAACTTAGTTCATATCTCGAGATATGAACTAAGTTTGTGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199081    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_006875.2-1693s1c1
Sequence:CCGGCCCTACTCTGTTATCCCAAGTCTCGAGACTTGGGATAACAGAGTAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000219888    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006875.2-701s1c1
Sequence:CCGGCTGTGCCAAACTCATTGATTTCTCGAGAAATCAATGAGTTTGGCACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006875
VALIDATED
PIM2 MISSION shRNA Lentiviral Transduction Particles
pim-2 oncogene
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000001627    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: A3
TRC Version: 1 Clone ID:NM_006875.x-1226s1c1
Sequence:CCGGCCAGTCATTAAAGTCCAGTATCTCGAGATACTGGACTTTAATGACTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001628    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A3
TRC Version: 1 Clone ID:NM_006875.x-549s1c1
Sequence:CCGGGCCCAGGATCTCTTTGACTATCTCGAGATAGTCAAAGAGATCCTGGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001630    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A3
TRC Version: 1 Clone ID:NM_006875.x-551s1c1
Sequence:CCGGCCAGGATCTCTTTGACTATATCTCGAGATATAGTCAAAGAGATCCTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001631    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A3
TRC Version: 1 Clone ID:NM_006875.x-491s1c1
Sequence:CCGGGCTTGACTGGTTTGAGACACACTCGAGTGTGTCTCAAACCAGTCAAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001629    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A3
TRC Version: 1 Clone ID:NM_006875.x-756s1c1
Sequence:CCGGGATGAACCCTACACTGACTTTCTCGAGAAAGTCAGTGTAGGGTTCATCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200008    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006875.2-336s1c1
Sequence:CCGGCGACTCCAGGTGGCCATCAAACTCGAGTTTGATGGCCACCTGGAGTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194699    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_006875.2-1473s1c1
Sequence:CCGGCCACACAAACTTAGTTCATATCTCGAGATATGAACTAAGTTTGTGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199081    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_006875.2-1693s1c1
Sequence:CCGGCCCTACTCTGTTATCCCAAGTCTCGAGACTTGGGATAACAGAGTAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219888    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006875.2-701s1c1
Sequence:CCGGCTGTGCCAAACTCATTGATTTCTCGAGAAATCAATGAGTTTGGCACAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)