EMAIL THIS PAGE TO A FRIEND

PIM3

pim-3 oncogene

65 Gene Product Result for
Synonyms: pim-3
UniProtKB ID: Q86V86, A5D8X8, A8K7J0, B1B0P0, Q68BM2
Gene ID:
Human(415116) Summary: The protein encoded by this gene belongs to the Ser/Thr protein kinase family, and PIM subfamily. This gene is overexpressed in hematological and epithelial tumors and is associated with MYC coexpression. It plays a role in the regulation of signal transduction cascades, contributing to both cell proliferation and survival, and provides a selective advantage in tumorigenesis. [provided by RefSeq, Jun 2012]
Mouse(223775) proviral integration site 3
Rat(64534) pim-3 oncogene
cow(100336651) pim-3 oncogene
naked mole-rat(101714030) pim-3 oncogene
Zebrafish(565041) pim-3 oncogene
chicken(768655) pim-3 oncogene
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001001852 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001001852 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001001852 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_145478 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145478 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145478 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU002621 MISSION® esiRNA targeting mouse Pim3 mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001001852 Rosetta Predictions human pricing
NM_022602 Rosetta Predictions rat pricing
NM_145478 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001001852 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00152603 predicted 1231
2 SASI_Hs01_00152604 predicted 1795
3 SASI_Hs01_00152605 predicted 1406
4 SASI_Hs01_00152606 predicted 1854
5 SASI_Hs01_00152607 predicted 1021
6 SASI_Hs02_00303961 predicted 1587
7 SASI_Hs01_00152608 predicted 525
8 SASI_Hs01_00152609 predicted 626
9 SASI_Hs01_00152610 predicted 526
10 SASI_Hs01_00152611 predicted 820
11 SASI_Hs01_00152612 predicted 555
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022602 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00117488 predicted 1475
2 SASI_Rn01_00117489 predicted 775
3 SASI_Rn01_00117490 predicted 981
4 SASI_Rn01_00117491 predicted 1526
5 SASI_Rn01_00117492 predicted 1078
6 SASI_Rn01_00117493 predicted 971
7 SASI_Rn01_00117494 predicted 824
8 SASI_Rn01_00117495 predicted 869
9 SASI_Rn01_00117496 predicted 1415
10 SASI_Rn01_00117497 predicted 1445
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145478 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00057521 predicted 1582
2 SASI_Mm01_00057522 predicted 1744
3 SASI_Mm01_00057523 predicted 1068
4 SASI_Mm01_00057524 predicted 1273
5 SASI_Mm01_00057525 predicted 1144
6 SASI_Mm01_00057526 predicted 1362
7 SASI_Mm01_00057527 predicted 1065
8 SASI_Mm01_00057528 predicted 1116
9 SASI_Mm02_00340881 predicted 1257
10 SASI_Mm01_00057529 predicted 1911
11 SASI_Mm01_00057530 predicted 1169
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001001852
VALIDATED
PIM3 MISSION shRNA Bacterial Glycerol Stock
pim-3 oncogene
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000360291    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001852.3-996s21c1
Sequence:CCGGCTCCGGAGAGCTCAAGCTCATCTCGAGATGAGCTTGAGCTCTCCGGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344426    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001852.3-841s21c1
Sequence:CCGGCAGGACCTCTTCGACTTTATCCTCGAGGATAAAGTCGAAGAGGTCCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196559    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001001852.2-2218s1c1
Sequence:CCGGGCGTTTAATTTATTCAGTACCCTCGAGGGTACTGAATAAATTAAACGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344367    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001852.3-1148s21c1
Sequence:CCGGGCGTGCTTCTCTACGATATGGCTCGAGCCATATCGTAGAGAAGCACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344364    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001852.3-1185s21c1
Sequence:CCGGCTTCGAGCAGGACGAGGAGATCTCGAGATCTCCTCGTCCTGCTCGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360292    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001852.3-651s21c1
Sequence:CCGGGGCTGTGAAGCACGTGGTGAACTCGAGTTCACCACGTGCTTCACAGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360293    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001852.3-1048s21c1
Sequence:CCGGACGGTCTACACCGACTTCGACCTCGAGGTCGAAGTCGGTGTAGACCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344425    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001852.3-948s21c1
Sequence:CCGGGGTCGTGCACCGCGACATTAACTCGAGTTAATGTCGCGGTGCACGACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037414    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_001001852.1-2063s1c1
Sequence:CCGGCGCCTGTCAGAAGATGAACATCTCGAGATGTTCATCTTCTGACAGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037418    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001852.1-1276s1c1
Sequence:CCGGCGGCCGTCGCTGGATCAGATTCTCGAGAATCTGATCCAGCGACGGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327916    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001001852.3-2081s21c1
Sequence:CCGGCGCCTGTCAGAAGATGAACATCTCGAGATGTTCATCTTCTGACAGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037415    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001852.1-822s1c1
Sequence:CCGGGCAGGACCTCTTCGACTTTATCTCGAGATAAAGTCGAAGAGGTCCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037417    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001852.1-522s1c1
Sequence:CCGGCAAGGCGGACAAGGAGAGCTTCTCGAGAAGCTCTCCTTGTCCGCCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037416    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001852.1-1131s1c1
Sequence:CCGGCGTGCTTCTCTACGATATGGTCTCGAGACCATATCGTAGAGAAGCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001001852
VALIDATED
PIM3 MISSION shRNA shRNA Plasmid DNA
pim-3 oncogene
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000360291    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001852.3-996s21c1
Sequence:CCGGCTCCGGAGAGCTCAAGCTCATCTCGAGATGAGCTTGAGCTCTCCGGAGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000344426    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001852.3-841s21c1
Sequence:CCGGCAGGACCTCTTCGACTTTATCCTCGAGGATAAAGTCGAAGAGGTCCTGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000196559    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001001852.2-2218s1c1
Sequence:CCGGGCGTTTAATTTATTCAGTACCCTCGAGGGTACTGAATAAATTAAACGCTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000344367    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001852.3-1148s21c1
Sequence:CCGGGCGTGCTTCTCTACGATATGGCTCGAGCCATATCGTAGAGAAGCACGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000344364    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001852.3-1185s21c1
Sequence:CCGGCTTCGAGCAGGACGAGGAGATCTCGAGATCTCCTCGTCCTGCTCGAAGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000360292    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001852.3-651s21c1
Sequence:CCGGGGCTGTGAAGCACGTGGTGAACTCGAGTTCACCACGTGCTTCACAGCCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000360293    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001852.3-1048s21c1
Sequence:CCGGACGGTCTACACCGACTTCGACCTCGAGGTCGAAGTCGGTGTAGACCGTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000344425    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001852.3-948s21c1
Sequence:CCGGGGTCGTGCACCGCGACATTAACTCGAGTTAATGTCGCGGTGCACGACCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000037414    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_001001852.1-2063s1c1
Sequence:CCGGCGCCTGTCAGAAGATGAACATCTCGAGATGTTCATCTTCTGACAGGCGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000037418    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001852.1-1276s1c1
Sequence:CCGGCGGCCGTCGCTGGATCAGATTCTCGAGAATCTGATCCAGCGACGGCCGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000327916    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001001852.3-2081s21c1
Sequence:CCGGCGCCTGTCAGAAGATGAACATCTCGAGATGTTCATCTTCTGACAGGCGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000037415    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001852.1-822s1c1
Sequence:CCGGGCAGGACCTCTTCGACTTTATCTCGAGATAAAGTCGAAGAGGTCCTGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000037417    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001852.1-522s1c1
Sequence:CCGGCAAGGCGGACAAGGAGAGCTTCTCGAGAAGCTCTCCTTGTCCGCCTTGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000037416    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001852.1-1131s1c1
Sequence:CCGGCGTGCTTCTCTACGATATGGTCTCGAGACCATATCGTAGAGAAGCACGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001001852
VALIDATED
PIM3 MISSION shRNA Lentiviral Transduction Particles
pim-3 oncogene
Human
14 Products Total
TRC Number Volume Titer/mL Vector Price Set Price (5+)? Select
TRCN0000360291    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001852.3-996s21c1
Sequence:CCGGCTCCGGAGAGCTCAAGCTCATCTCGAGATGAGCTTGAGCTCTCCGGAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000344426    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001852.3-841s21c1
Sequence:CCGGCAGGACCTCTTCGACTTTATCCTCGAGGATAAAGTCGAAGAGGTCCTGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196559    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001001852.2-2218s1c1
Sequence:CCGGGCGTTTAATTTATTCAGTACCCTCGAGGGTACTGAATAAATTAAACGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000344367    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001852.3-1148s21c1
Sequence:CCGGGCGTGCTTCTCTACGATATGGCTCGAGCCATATCGTAGAGAAGCACGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000344364    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001852.3-1185s21c1
Sequence:CCGGCTTCGAGCAGGACGAGGAGATCTCGAGATCTCCTCGTCCTGCTCGAAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000360292    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001852.3-651s21c1
Sequence:CCGGGGCTGTGAAGCACGTGGTGAACTCGAGTTCACCACGTGCTTCACAGCCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000360293    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001852.3-1048s21c1
Sequence:CCGGACGGTCTACACCGACTTCGACCTCGAGGTCGAAGTCGGTGTAGACCGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000344425    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001852.3-948s21c1
Sequence:CCGGGGTCGTGCACCGCGACATTAACTCGAGTTAATGTCGCGGTGCACGACCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037414    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_001001852.1-2063s1c1
Sequence:CCGGCGCCTGTCAGAAGATGAACATCTCGAGATGTTCATCTTCTGACAGGCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037418    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001852.1-1276s1c1
Sequence:CCGGCGGCCGTCGCTGGATCAGATTCTCGAGAATCTGATCCAGCGACGGCCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000327916    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001001852.3-2081s21c1
Sequence:CCGGCGCCTGTCAGAAGATGAACATCTCGAGATGTTCATCTTCTGACAGGCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037415    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001852.1-822s1c1
Sequence:CCGGGCAGGACCTCTTCGACTTTATCTCGAGATAAAGTCGAAGAGGTCCTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037417    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001852.1-522s1c1
Sequence:CCGGCAAGGCGGACAAGGAGAGCTTCTCGAGAAGCTCTCCTTGTCCGCCTTGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037416    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001852.1-1131s1c1
Sequence:CCGGCGTGCTTCTCTACGATATGGTCTCGAGACCATATCGTAGAGAAGCACGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145478
VALIDATED
PIM3 MISSION shRNA Bacterial Glycerol Stock
pim-3 oncogene
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000276665    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145478.2-1909s21c1
Sequence:CCGGTGCCACCACGGTCTCTTATTTCTCGAGAAATAAGAGACCGTGGTGGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024124    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145478.1-1275s1c1
Sequence:CCGGGCAGCTTATTGAGTGGTGTCTCTCGAGAGACACCACTCAATAAGCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024125    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145478.1-1117s1c1
Sequence:CCGGTGGATCCGATATCACCGATATCTCGAGATATCGGTGATATCGGATCCATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024128    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145478.1-822s1c1
Sequence:CCGGCGACGGCTTCTTGTTGGTGCTCTCGAGAGCACCAACAAGAAGCCGTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024126    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145478.1-538s1c1
Sequence:CCGGCCAGTGAAGATCCTACAGCCACTCGAGTGGCTGTAGGATCTTCACTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024127    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145478.1-1379s1c1
Sequence:CCGGAGAACTGTGACCTTCGGCTTTCTCGAGAAAGCCGAAGGTCACAGTTCTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000285622    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145478.2-1379s21c1
Sequence:CCGGAGAACTGTGACCTTCGGCTTTCTCGAGAAAGCCGAAGGTCACAGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276727    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145478.2-861s21c1
Sequence:CCGGACAGGACCTCTTCGACTTCATCTCGAGATGAAGTCGAAGAGGTCCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276664    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145478.2-1275s21c1
Sequence:CCGGGCAGCTTATTGAGTGGTGTCTCTCGAGAGACACCACTCAATAAGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145478
VALIDATED
PIM3 MISSION shRNA shRNA Plasmid DNA
pim-3 oncogene
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000276665    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145478.2-1909s21c1
Sequence:CCGGTGCCACCACGGTCTCTTATTTCTCGAGAAATAAGAGACCGTGGTGGCATTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000024124    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145478.1-1275s1c1
Sequence:CCGGGCAGCTTATTGAGTGGTGTCTCTCGAGAGACACCACTCAATAAGCTGCTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000024125    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145478.1-1117s1c1
Sequence:CCGGTGGATCCGATATCACCGATATCTCGAGATATCGGTGATATCGGATCCATTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000024128    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145478.1-822s1c1
Sequence:CCGGCGACGGCTTCTTGTTGGTGCTCTCGAGAGCACCAACAAGAAGCCGTCGTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000024126    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145478.1-538s1c1
Sequence:CCGGCCAGTGAAGATCCTACAGCCACTCGAGTGGCTGTAGGATCTTCACTGGTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000024127    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145478.1-1379s1c1
Sequence:CCGGAGAACTGTGACCTTCGGCTTTCTCGAGAAAGCCGAAGGTCACAGTTCTTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000285622    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145478.2-1379s21c1
Sequence:CCGGAGAACTGTGACCTTCGGCTTTCTCGAGAAAGCCGAAGGTCACAGTTCTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000276727    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145478.2-861s21c1
Sequence:CCGGACAGGACCTCTTCGACTTCATCTCGAGATGAAGTCGAAGAGGTCCTGTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000276664    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145478.2-1275s21c1
Sequence:CCGGGCAGCTTATTGAGTGGTGTCTCTCGAGAGACACCACTCAATAAGCTGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145478
VALIDATED
PIM3 MISSION shRNA Lentiviral Transduction Particles
pim-3 oncogene
Mouse
9 Products Total
TRC Number Volume Titer/mL Vector Price Set Price (5+)? Select
TRCN0000276665    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145478.2-1909s21c1
Sequence:CCGGTGCCACCACGGTCTCTTATTTCTCGAGAAATAAGAGACCGTGGTGGCATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024124    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145478.1-1275s1c1
Sequence:CCGGGCAGCTTATTGAGTGGTGTCTCTCGAGAGACACCACTCAATAAGCTGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024125    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145478.1-1117s1c1
Sequence:CCGGTGGATCCGATATCACCGATATCTCGAGATATCGGTGATATCGGATCCATTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024128    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145478.1-822s1c1
Sequence:CCGGCGACGGCTTCTTGTTGGTGCTCTCGAGAGCACCAACAAGAAGCCGTCGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024126    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145478.1-538s1c1
Sequence:CCGGCCAGTGAAGATCCTACAGCCACTCGAGTGGCTGTAGGATCTTCACTGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024127    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145478.1-1379s1c1
Sequence:CCGGAGAACTGTGACCTTCGGCTTTCTCGAGAAAGCCGAAGGTCACAGTTCTTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000285622    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145478.2-1379s21c1
Sequence:CCGGAGAACTGTGACCTTCGGCTTTCTCGAGAAAGCCGAAGGTCACAGTTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000276727    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145478.2-861s21c1
Sequence:CCGGACAGGACCTCTTCGACTTCATCTCGAGATGAAGTCGAAGAGGTCCTGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000276664    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145478.2-1275s21c1
Sequence:CCGGGCAGCTTATTGAGTGGTGTCTCTCGAGAGACACCACTCAATAAGCTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)