EMAIL THIS PAGE TO A FRIEND

PIN1

peptidylprolyl cis/trans isomerase, NIMA-interacting 1

52 Gene Product Result for
Synonyms: DOD UBL5
UniProtKB ID: Q13526, A8K4V9, Q53X75
Gene ID:
Human(5300) Summary: Peptidyl-prolyl cis/trans isomerases (PPIases) catalyze the cis/trans isomerization of peptidyl-prolyl peptide bonds. This gene encodes one of the PPIases, which specifically binds to phosphorylated ser/thr-pro motifs to catalytically regulate the post-phosphorylation conformation of its substrates. The conformational regulation catalyzed by this PPIase has a profound impact on key proteins involved in the regulation of cell growth, genotoxic and other stress responses, the immune response, induction and maintenance of pluripotency, germ cell development, neuronal differentiation, and survival. This enzyme also plays a key role in the pathogenesis of Alzheimer's disease and many cancers. Multiple alternatively spliced transcript variants have been found for this gene.[provided by RefSeq, Jun 2011]
Mouse(23988) protein (peptidyl-prolyl cis/trans isomerase) NIMA-interacting 1
Rat(298696) peptidylprolyl cis/trans isomerase, NIMA-interacting 1
Thale Cress(843693) auxin efflux carrier component 1
Zebrafish(393721) protein (peptidyl-prolyl cis/trans isomerase) NIMA-interacting 1
domestic cat(101087904) peptidylprolyl cis/trans isomerase, NIMA-interacting 1
dog(484963) peptidylprolyl cis/trans isomerase, NIMA-interacting 1
chicken(100859153) peptidylprolyl cis/trans isomerase, NIMA-interacting 1
naked mole-rat(101708402) peptidylprolyl cis/trans isomerase, NIMA-interacting 1
domestic guinea pig(100726337) peptidylprolyl cis/trans isomerase, NIMA-interacting 1
cow(535470) peptidylprolyl cis/trans isomerase, NIMA-interacting 1
sheep(101110756) peptidylprolyl cis/trans isomerase, NIMA-interacting 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_023371 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_023371 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_023371 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006221 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006221 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006221 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006221 siRNAs that have been validated in the lab human pricing
NM_001106701 Rosetta Predictions rat pricing
NM_023371 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006221 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00180077 validated 619
1 SASI_Hs01_00180076 validated 718
1 SASI_Hs01_00180075 validated 324
2 SASI_Hs01_00180079 predicted 468
3 SASI_Hs01_00180081 predicted 615
4 SASI_Hs01_00180082 predicted 612
5 SASI_Hs01_00180083 predicted 716
6 SASI_Hs01_00180084 predicted 449
7 SASI_Hs02_00341132 predicted 732
8 SASI_Hs02_00341133 predicted 345
9 SASI_Hs01_00180078 predicted 336
10 SASI_Hs01_00180080 predicted 391
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106701 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00221538 predicted 574
2 SASI_Rn02_00221539 predicted 408
3 SASI_Rn02_00221540 predicted 396
4 SASI_Rn02_00221541 predicted 555
5 SASI_Rn02_00221542 predicted 565
6 SASI_Rn02_00221543 predicted 554
7 SASI_Rn02_00221544 predicted 407
8 SASI_Rn02_00221545 predicted 400
9 SASI_Rn02_00221546 predicted 275
10 SASI_Rn02_00221547 predicted 493
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023371 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00072670 predicted 281
2 SASI_Mm01_00072671 predicted 397
3 SASI_Mm01_00072673 predicted 571
4 SASI_Mm01_00072674 predicted 874
5 SASI_Mm01_00072675 predicted 284
6 SASI_Mm01_00072676 predicted 986
7 SASI_Mm01_00072677 predicted 827
8 SASI_Mm01_00072678 predicted 541
9 SASI_Mm01_00072679 predicted 551
10 SASI_Mm02_00327078 predicted 564
11 SASI_Mm01_00072672 predicted 990
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023371
VALIDATED
PIN1 MISSION shRNA Bacterial Glycerol Stock
peptidylprolyl cis/trans isomerase, NIMA-interacting 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000012578    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023371.2-2139s1c1
Sequence:CCGGGCCATGTGATTTGGTATCTATCTCGAGATAGATACCAAATCACATGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023371.2-284s1c1
Sequence:CCGGCAATGGCTATATCCAGAAGATCTCGAGATCTTCTGGATATAGCCATTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012579    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_023371.2-397s1c1
Sequence:CCGGGAGGTCAGATGCAGAAACCATCTCGAGATGGTTTCTGCATCTGACCTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012581    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023371.2-40s1c1
Sequence:CCGGGCTGGGAGAAGCGTATGAGTCCTCGAGGACTCATACGCTTCTCCCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012580    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_023371.2-414s1c1
Sequence:CCGGCCATTTGAGGATGCGTCGTTTCTCGAGAAACGACGCATCCTCAAATGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321125    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023371.3-73s21c1
Sequence:CCGGGGTGTACTACTTCAATCACATCTCGAGATGTGATTGAAGTAGTACACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321191    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_023371.3-396s21c1
Sequence:CCGGGAGGTCAGATGCAGAAACCATCTCGAGATGGTTTCTGCATCTGACCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321193    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_023371.3-883s21c1
Sequence:CCGGCCTACGCACCTTCCATTAAATCTCGAGATTTAATGGAAGGTGCGTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321124    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_023371.3-136s21c1
Sequence:CCGGTGTTGGAGGCAGCAGCAAGAACTCGAGTTCTTGCTGCTGCCTCCAACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321192    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_023371.3-413s21c1
Sequence:CCGGCCATTTGAGGATGCGTCGTTTCTCGAGAAACGACGCATCCTCAAATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023371
VALIDATED
PIN1 MISSION shRNA shRNA Plasmid DNA
peptidylprolyl cis/trans isomerase, NIMA-interacting 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000012578    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023371.2-2139s1c1
Sequence:CCGGGCCATGTGATTTGGTATCTATCTCGAGATAGATACCAAATCACATGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023371.2-284s1c1
Sequence:CCGGCAATGGCTATATCCAGAAGATCTCGAGATCTTCTGGATATAGCCATTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012579    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_023371.2-397s1c1
Sequence:CCGGGAGGTCAGATGCAGAAACCATCTCGAGATGGTTTCTGCATCTGACCTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012581    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023371.2-40s1c1
Sequence:CCGGGCTGGGAGAAGCGTATGAGTCCTCGAGGACTCATACGCTTCTCCCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012580    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_023371.2-414s1c1
Sequence:CCGGCCATTTGAGGATGCGTCGTTTCTCGAGAAACGACGCATCCTCAAATGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000321125    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023371.3-73s21c1
Sequence:CCGGGGTGTACTACTTCAATCACATCTCGAGATGTGATTGAAGTAGTACACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000321191    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_023371.3-396s21c1
Sequence:CCGGGAGGTCAGATGCAGAAACCATCTCGAGATGGTTTCTGCATCTGACCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000321193    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_023371.3-883s21c1
Sequence:CCGGCCTACGCACCTTCCATTAAATCTCGAGATTTAATGGAAGGTGCGTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000321124    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_023371.3-136s21c1
Sequence:CCGGTGTTGGAGGCAGCAGCAAGAACTCGAGTTCTTGCTGCTGCCTCCAACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000321192    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_023371.3-413s21c1
Sequence:CCGGCCATTTGAGGATGCGTCGTTTCTCGAGAAACGACGCATCCTCAAATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023371
VALIDATED
PIN1 MISSION shRNA Lentiviral Transduction Particles
peptidylprolyl cis/trans isomerase, NIMA-interacting 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000012578    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023371.2-2139s1c1
Sequence:CCGGGCCATGTGATTTGGTATCTATCTCGAGATAGATACCAAATCACATGGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023371.2-284s1c1
Sequence:CCGGCAATGGCTATATCCAGAAGATCTCGAGATCTTCTGGATATAGCCATTGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012579    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_023371.2-397s1c1
Sequence:CCGGGAGGTCAGATGCAGAAACCATCTCGAGATGGTTTCTGCATCTGACCTCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012581    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023371.2-40s1c1
Sequence:CCGGGCTGGGAGAAGCGTATGAGTCCTCGAGGACTCATACGCTTCTCCCAGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012580    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_023371.2-414s1c1
Sequence:CCGGCCATTTGAGGATGCGTCGTTTCTCGAGAAACGACGCATCCTCAAATGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000321125    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023371.3-73s21c1
Sequence:CCGGGGTGTACTACTTCAATCACATCTCGAGATGTGATTGAAGTAGTACACCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000321191    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_023371.3-396s21c1
Sequence:CCGGGAGGTCAGATGCAGAAACCATCTCGAGATGGTTTCTGCATCTGACCTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000321193    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_023371.3-883s21c1
Sequence:CCGGCCTACGCACCTTCCATTAAATCTCGAGATTTAATGGAAGGTGCGTAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000321124    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_023371.3-136s21c1
Sequence:CCGGTGTTGGAGGCAGCAGCAAGAACTCGAGTTCTTGCTGCTGCCTCCAACATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000321192    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_023371.3-413s21c1
Sequence:CCGGCCATTTGAGGATGCGTCGTTTCTCGAGAAACGACGCATCCTCAAATGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006221
VALIDATED
PIN1 MISSION shRNA Bacterial Glycerol Stock
peptidylprolyl cis/trans isomerase, NIMA-interacting 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000318360    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006221.2-301s21c1
Sequence:CCGGCCAGAAGATCAAGTCGGGAGACTCGAGTCTCCCGACTTGATCTTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318417    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006221.2-418s21c1
Sequence:CCGGGCCATTTGAAGACGCCTCGTTCTCGAGAACGAGGCGTCTTCAAATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010577    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006221.x-420s1c1
Sequence:CCGGGCCATTTGAAGACGCCTCGTTCTCGAGAACGAGGCGTCTTCAAATGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001036    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006221.x-248s1c1
Sequence:CCGGAGGAGAAGATCACCCGGACCACTCGAGTGGTCCGGGTGATCTTCTCCTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001035    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006221.x-416s1c1
Sequence:CCGGAGAAGCCATTTGAAGACGCCTCTCGAGAGGCGTCTTCAAATGGCTTCTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001034    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006221.x-303s1c1
Sequence:CCGGCCAGAAGATCAAGTCGGGAGACTCGAGTCTCCCGACTTGATCTTCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001033    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006221.x-616s1c1
Sequence:CCGGCCACCGTCACACAGTATTTATCTCGAGATAAATACTGTGTGACGGTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318418    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006221.2-614s21c1
Sequence:CCGGCCACCGTCACACAGTATTTATCTCGAGATAAATACTGTGTGACGGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318359    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006221.2-246s21c1
Sequence:CCGGAGGAGAAGATCACCCGGACCACTCGAGTGGTCCGGGTGATCTTCTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006221
VALIDATED
PIN1 MISSION shRNA shRNA Plasmid DNA
peptidylprolyl cis/trans isomerase, NIMA-interacting 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000318360    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006221.2-301s21c1
Sequence:CCGGCCAGAAGATCAAGTCGGGAGACTCGAGTCTCCCGACTTGATCTTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000318417    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006221.2-418s21c1
Sequence:CCGGGCCATTTGAAGACGCCTCGTTCTCGAGAACGAGGCGTCTTCAAATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010577    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006221.x-420s1c1
Sequence:CCGGGCCATTTGAAGACGCCTCGTTCTCGAGAACGAGGCGTCTTCAAATGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001036    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006221.x-248s1c1
Sequence:CCGGAGGAGAAGATCACCCGGACCACTCGAGTGGTCCGGGTGATCTTCTCCTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001035    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006221.x-416s1c1
Sequence:CCGGAGAAGCCATTTGAAGACGCCTCTCGAGAGGCGTCTTCAAATGGCTTCTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001034    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006221.x-303s1c1
Sequence:CCGGCCAGAAGATCAAGTCGGGAGACTCGAGTCTCCCGACTTGATCTTCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001033    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006221.x-616s1c1
Sequence:CCGGCCACCGTCACACAGTATTTATCTCGAGATAAATACTGTGTGACGGTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000318418    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006221.2-614s21c1
Sequence:CCGGCCACCGTCACACAGTATTTATCTCGAGATAAATACTGTGTGACGGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000318359    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006221.2-246s21c1
Sequence:CCGGAGGAGAAGATCACCCGGACCACTCGAGTGGTCCGGGTGATCTTCTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006221
VALIDATED
PIN1 MISSION shRNA Lentiviral Transduction Particles
peptidylprolyl cis/trans isomerase, NIMA-interacting 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000318360    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006221.2-301s21c1
Sequence:CCGGCCAGAAGATCAAGTCGGGAGACTCGAGTCTCCCGACTTGATCTTCTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000318417    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006221.2-418s21c1
Sequence:CCGGGCCATTTGAAGACGCCTCGTTCTCGAGAACGAGGCGTCTTCAAATGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010577    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006221.x-420s1c1
Sequence:CCGGGCCATTTGAAGACGCCTCGTTCTCGAGAACGAGGCGTCTTCAAATGGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001036    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006221.x-248s1c1
Sequence:CCGGAGGAGAAGATCACCCGGACCACTCGAGTGGTCCGGGTGATCTTCTCCTTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001035    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006221.x-416s1c1
Sequence:CCGGAGAAGCCATTTGAAGACGCCTCTCGAGAGGCGTCTTCAAATGGCTTCTTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001034    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006221.x-303s1c1
Sequence:CCGGCCAGAAGATCAAGTCGGGAGACTCGAGTCTCCCGACTTGATCTTCTGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001033    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006221.x-616s1c1
Sequence:CCGGCCACCGTCACACAGTATTTATCTCGAGATAAATACTGTGTGACGGTGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000318418    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006221.2-614s21c1
Sequence:CCGGCCACCGTCACACAGTATTTATCTCGAGATAAATACTGTGTGACGGTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000318359    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006221.2-246s21c1
Sequence:CCGGAGGAGAAGATCACCCGGACCACTCGAGTGGTCCGGGTGATCTTCTCCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)