EMAIL THIS PAGE TO A FRIEND

PIN1P1

peptidylprolyl cis/trans isomerase, NIMA-interacting 1 pseudogene 1

33 Gene Product Result for
Synonyms: PIN1L
Species: Human PIN1P1(5301)
UniProtKB ID: O15428, B2RBW1, Q5VW75
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006222 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006222 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006222 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XR_017802 Rosetta Predictions human pricing
XR_017814 Rosetta Predictions human pricing
XR_040597 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_017802 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00494618 predicted 328
2 SASI_Hs02_00494619 predicted 497
3 SASI_Hs02_00494620 predicted 596
4 SASI_Hs02_00494621 predicted 457
5 SASI_Hs02_00494622 predicted 716
6 SASI_Hs02_00494623 predicted 726
7 SASI_Hs02_00494624 predicted 207
8 SASI_Hs02_00494625 predicted 1129
9 SASI_Hs02_00494626 predicted 1161
10 SASI_Hs02_00494627 predicted 1143
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_017814 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00494693 predicted 332
2 SASI_Hs02_00494694 predicted 493
3 SASI_Hs02_00494695 predicted 597
4 SASI_Hs02_00494696 predicted 457
5 SASI_Hs02_00494697 predicted 717
6 SASI_Hs02_00494698 predicted 721
7 SASI_Hs02_00494699 predicted 208
8 SASI_Hs02_00494700 predicted 1124
9 SASI_Hs02_00494701 predicted 1167
10 SASI_Hs02_00494702 predicted 1138
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040597 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00520285 predicted 332
2 SASI_Hs02_00520286 predicted 494
3 SASI_Hs02_00520287 predicted 601
4 SASI_Hs02_00520288 predicted 456
5 SASI_Hs02_00520289 predicted 717
6 SASI_Hs02_00520290 predicted 723
7 SASI_Hs02_00520291 predicted 208
8 SASI_Hs02_00520292 predicted 1123
9 SASI_Hs02_00520293 predicted 1159
10 SASI_Hs02_00520294 predicted 1137
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006222
PIN1P1 MISSION shRNA Bacterial Glycerol Stock
peptidylprolyl cis/trans isomerase, NIMA-interacting 1 pseudogene 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000049209    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006222.1-212s1c1
Sequence:CCGGCCTGCTAGTGAAGCCAGTCAACTCGAGTTGACTGGCTTCACTAGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049210    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006222.1-315s1c1
Sequence:CCGGCAAGGCAGGAGAGAAGGACTTCTCGAGAAGTCCTTCTCTCCTGCCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049211    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006222.1-297s1c1
Sequence:CCGGCGGCTACATCCAGAAGATCAACTCGAGTTGATCTTCTGGATGTAGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049208    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006222.1-252s1c1
Sequence:CCGGGCAGGAAATCACCCGGACCAACTCGAGTTGGTCCGGGTGATTTCCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049212    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006222.1-98s1c1
Sequence:CCGGAGGGTACTACTTCAACCACATCTCGAGATGTGGTTGAAGTAGTACCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006222
PIN1P1 MISSION shRNA shRNA Plasmid DNA
peptidylprolyl cis/trans isomerase, NIMA-interacting 1 pseudogene 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000049209    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006222.1-212s1c1
Sequence:CCGGCCTGCTAGTGAAGCCAGTCAACTCGAGTTGACTGGCTTCACTAGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049210    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006222.1-315s1c1
Sequence:CCGGCAAGGCAGGAGAGAAGGACTTCTCGAGAAGTCCTTCTCTCCTGCCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049211    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006222.1-297s1c1
Sequence:CCGGCGGCTACATCCAGAAGATCAACTCGAGTTGATCTTCTGGATGTAGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049208    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006222.1-252s1c1
Sequence:CCGGGCAGGAAATCACCCGGACCAACTCGAGTTGGTCCGGGTGATTTCCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049212    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006222.1-98s1c1
Sequence:CCGGAGGGTACTACTTCAACCACATCTCGAGATGTGGTTGAAGTAGTACCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006222
PIN1P1 MISSION shRNA Lentiviral Transduction Particles
peptidylprolyl cis/trans isomerase, NIMA-interacting 1 pseudogene 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000049209    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006222.1-212s1c1
Sequence:CCGGCCTGCTAGTGAAGCCAGTCAACTCGAGTTGACTGGCTTCACTAGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049210    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006222.1-315s1c1
Sequence:CCGGCAAGGCAGGAGAGAAGGACTTCTCGAGAAGTCCTTCTCTCCTGCCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049211    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006222.1-297s1c1
Sequence:CCGGCGGCTACATCCAGAAGATCAACTCGAGTTGATCTTCTGGATGTAGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049208    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006222.1-252s1c1
Sequence:CCGGGCAGGAAATCACCCGGACCAACTCGAGTTGGTCCGGGTGATTTCCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049212    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006222.1-98s1c1
Sequence:CCGGAGGGTACTACTTCAACCACATCTCGAGATGTGGTTGAAGTAGTACCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)