EMAIL THIS PAGE TO A FRIEND

PIN4

protein (peptidylprolyl cis/trans isomerase) NIMA-interacting, 4 (parvulin)

114 Gene Product Result for
Synonyms: EPVH PAR14 PAR17
Gene ID:
Human(5303) Summary: This gene encodes a member of the parvulin subfamily of the peptidyl-prolyl cis/trans isomerase protein family. The encoded protein catalyzes the isomerization of peptidylprolyl bonds, and may play a role in the cell cycle, chromatin remodeling, and/or ribosome biogenesis. The encoded protein may play an additional role in the mitochondria. [provided by RefSeq, Dec 2009]
Mouse(69713) protein (peptidyl-prolyl cis/trans isomerase) NIMA-interacting, 4 (parvulin)
Rat(684441) protein (peptidylprolyl cis/trans isomerase) NIMA-interacting, 4 (parvulin)
Thale Cress(814670) auxin efflux carrier component 4
Zebrafish(553574) protein (peptidylprolyl cis/trans isomerase) NIMA-interacting, 4 (parvulin)
domestic cat(101095318) protein (peptidylprolyl cis/trans isomerase) NIMA-interacting, 4 (parvulin)
dog(607878) protein (peptidylprolyl cis/trans isomerase) NIMA-interacting, 4 (parvulin)
chicken(422134) protein (peptidylprolyl cis/trans isomerase) NIMA-interacting, 4 (parvulin)
cow(100126055) protein (peptidylprolyl cis/trans isomerase) NIMA-interacting, 4 (parvulin)
sheep(101108722) protein (peptidylprolyl cis/trans isomerase) NIMA-interacting, 4 (parvulin)
domestic guinea pig(100734634) protein (peptidylprolyl cis/trans isomerase) NIMA-interacting, 4 (parvulin)
naked mole-rat(101726044) protein (peptidylprolyl cis/trans isomerase) NIMA-interacting, 4 (parvulin)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_027181 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027181 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027181 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006223 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006223 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006223 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006223 Rosetta Predictions human pricing
XM_001070406 Rosetta Predictions rat pricing
NM_027181 Rosetta Predictions mouse pricing
XM_135990 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006223 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00229738 predicted 748
2 SASI_Hs01_00229740 predicted 467
3 SASI_Hs01_00229741 predicted 608
4 SASI_Hs01_00229743 predicted 422
5 SASI_Hs01_00229744 predicted 835
6 SASI_Hs01_00229745 predicted 643
7 SASI_Hs02_00341134 predicted 423
8 SASI_Hs01_00229746 predicted 680
9 SASI_Hs01_00229747 predicted 436
10 SASI_Hs02_00341135 predicted 689
11 SASI_Hs01_00229739 predicted 506
12 SASI_Hs01_00229742 predicted 410
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001070406 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00331554 predicted 286
2 SASI_Rn02_00331555 predicted 209
3 SASI_Rn02_00331556 predicted 191
4 SASI_Rn02_00331557 predicted 211
5 SASI_Rn02_00331558 predicted 287
6 SASI_Rn02_00331559 predicted 266
7 SASI_Rn02_00331560 predicted 207
8 SASI_Rn02_00331561 predicted 206
9 SASI_Rn02_00331562 predicted 205
10 SASI_Rn02_00331563 predicted 205
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027181 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00331698 predicted 228
2 SASI_Mm02_00331699 predicted 222
3 SASI_Mm02_00331700 predicted 230
4 SASI_Mm02_00331701 predicted 223
5 SASI_Mm02_00331702 predicted 243
6 SASI_Mm02_00331703 predicted 203
7 SASI_Mm02_00331704 predicted 246
8 SASI_Mm02_00331705 predicted 257
9 SASI_Mm02_00331706 predicted 254
10 SASI_Mm02_00331707 predicted 255
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_135990 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00229017 predicted 255
2 SASI_Mm01_00229018 predicted 250
3 SASI_Mm01_00229019 predicted 230
4 SASI_Mm01_00229020 predicted 251
5 SASI_Mm01_00229021 predicted 243
6 SASI_Mm01_00229022 predicted 237
7 SASI_Mm01_00229023 predicted 258
8 SASI_Mm01_00229024 predicted 240
9 SASI_Mm01_00229025 predicted 236
10 SASI_Mm01_00229026 predicted 213
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027181
VALIDATED
PIN4 MISSION shRNA Bacterial Glycerol Stock
protein (peptidylprolyl cis/trans isomerase) NIMA-interacting, 4 (parvulin)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000353246    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027181.1-167s21c1
Sequence:CCGGCAGTAAAGGTCAGACACATTCCTCGAGGAATGTGTCTGACCTTTACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000346210    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027181.1-252s21c1
Sequence:CCGGTGAAGTGGCCACACAATATAGCTCGAGCTATATTGTGTGGCCACTTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000346211    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027181.1-134s21c1
Sequence:CCGGAGAAGTCTCAGGGTCCTAAAGCTCGAGCTTTAGGACCCTGAGACTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000346213    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027181.1-229s21c1
Sequence:CCGGTTAAAGTCTGGGATGAGATTCCTCGAGGAATCTCATCCCAGACTTTAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252599    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027181.1-360s21c1
Sequence:CCGGGCCTGTAAGTGGGATGGATAACTCGAGTTATCCATCCCACTTACAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027181
VALIDATED
PIN4 MISSION shRNA shRNA Plasmid DNA
protein (peptidylprolyl cis/trans isomerase) NIMA-interacting, 4 (parvulin)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000353246    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027181.1-167s21c1
Sequence:CCGGCAGTAAAGGTCAGACACATTCCTCGAGGAATGTGTCTGACCTTTACTGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000346210    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027181.1-252s21c1
Sequence:CCGGTGAAGTGGCCACACAATATAGCTCGAGCTATATTGTGTGGCCACTTCATTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000346211    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027181.1-134s21c1
Sequence:CCGGAGAAGTCTCAGGGTCCTAAAGCTCGAGCTTTAGGACCCTGAGACTTCTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000346213    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027181.1-229s21c1
Sequence:CCGGTTAAAGTCTGGGATGAGATTCCTCGAGGAATCTCATCCCAGACTTTAATTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000252599    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027181.1-360s21c1
Sequence:CCGGGCCTGTAAGTGGGATGGATAACTCGAGTTATCCATCCCACTTACAGGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027181
VALIDATED
PIN4 MISSION shRNA Lentiviral Transduction Particles
protein (peptidylprolyl cis/trans isomerase) NIMA-interacting, 4 (parvulin)
Mouse
5 Products Total
TRC Number Volume Titer/mL Vector Price Set Price (5+)? Select
TRCN0000353246    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027181.1-167s21c1
Sequence:CCGGCAGTAAAGGTCAGACACATTCCTCGAGGAATGTGTCTGACCTTTACTGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000346210    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027181.1-252s21c1
Sequence:CCGGTGAAGTGGCCACACAATATAGCTCGAGCTATATTGTGTGGCCACTTCATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000346211    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027181.1-134s21c1
Sequence:CCGGAGAAGTCTCAGGGTCCTAAAGCTCGAGCTTTAGGACCCTGAGACTTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000346213    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027181.1-229s21c1
Sequence:CCGGTTAAAGTCTGGGATGAGATTCCTCGAGGAATCTCATCCCAGACTTTAATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252599    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027181.1-360s21c1
Sequence:CCGGGCCTGTAAGTGGGATGGATAACTCGAGTTATCCATCCCACTTACAGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006223
VALIDATED
PIN4 MISSION shRNA Bacterial Glycerol Stock
protein (peptidylprolyl cis/trans isomerase) NIMA-interacting, 4 (parvulin)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000327689    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006223.2-228s21c1
Sequence:CCGGGTCAGACACATTCTATGTGAACTCGAGTTCACATAGAATGTGTCTGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327765    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006223.2-313s21c1
Sequence:CCGGCCGCACAGTATAGTGAAGATACTCGAGTATCTTCACTATACTGTGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312558    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006223.2-791s21c1
Sequence:CCGGCTCTCAGTCTGTCCCATAAATCTCGAGATTTATGGGACAGACTGAGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000349737    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006223.2-78s21c1
Sequence:CCGGGAGCGGTTCAGCGTTCAACAACTCGAGTTGTTGAACGCTGAACCGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049218    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006223.2-313s1c1
Sequence:CCGGCCGCACAGTATAGTGAAGATACTCGAGTATCTTCACTATACTGTGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049219    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006223.2-219s1c1
Sequence:CCGGGCAGTAAAGGTCAGACACATTCTCGAGAATGTGTCTGACCTTTACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049220    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006223.2-413s1c1
Sequence:CCGGGCCTGTAAGTGGGATGGATAACTCGAGTTATCCATCCCACTTACAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049222    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006223.2-228s1c1
Sequence:CCGGGTCAGACACATTCTATGTGAACTCGAGTTCACATAGAATGTGTCTGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049221    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006223.2-81s1c1
Sequence:CCGGCGGTTCAGCGTTCAACAACAACTCGAGTTGTTGTTGAACGCTGAACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327792    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006223.2-413s21c1
Sequence:CCGGGCCTGTAAGTGGGATGGATAACTCGAGTTATCCATCCCACTTACAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006223
VALIDATED
PIN4 MISSION shRNA shRNA Plasmid DNA
protein (peptidylprolyl cis/trans isomerase) NIMA-interacting, 4 (parvulin)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000327689    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006223.2-228s21c1
Sequence:CCGGGTCAGACACATTCTATGTGAACTCGAGTTCACATAGAATGTGTCTGACTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000327765    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006223.2-313s21c1
Sequence:CCGGCCGCACAGTATAGTGAAGATACTCGAGTATCTTCACTATACTGTGCGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000312558    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006223.2-791s21c1
Sequence:CCGGCTCTCAGTCTGTCCCATAAATCTCGAGATTTATGGGACAGACTGAGAGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000349737    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006223.2-78s21c1
Sequence:CCGGGAGCGGTTCAGCGTTCAACAACTCGAGTTGTTGAACGCTGAACCGCTCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000049218    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006223.2-313s1c1
Sequence:CCGGCCGCACAGTATAGTGAAGATACTCGAGTATCTTCACTATACTGTGCGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000049219    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006223.2-219s1c1
Sequence:CCGGGCAGTAAAGGTCAGACACATTCTCGAGAATGTGTCTGACCTTTACTGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000049220    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006223.2-413s1c1
Sequence:CCGGGCCTGTAAGTGGGATGGATAACTCGAGTTATCCATCCCACTTACAGGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000049222    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006223.2-228s1c1
Sequence:CCGGGTCAGACACATTCTATGTGAACTCGAGTTCACATAGAATGTGTCTGACTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000049221    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006223.2-81s1c1
Sequence:CCGGCGGTTCAGCGTTCAACAACAACTCGAGTTGTTGTTGAACGCTGAACCGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000327792    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006223.2-413s21c1
Sequence:CCGGGCCTGTAAGTGGGATGGATAACTCGAGTTATCCATCCCACTTACAGGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006223
VALIDATED
PIN4 MISSION shRNA Lentiviral Transduction Particles
protein (peptidylprolyl cis/trans isomerase) NIMA-interacting, 4 (parvulin)
Human
10 Products Total
TRC Number Volume Titer/mL Vector Price Set Price (5+)? Select
TRCN0000327689    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006223.2-228s21c1
Sequence:CCGGGTCAGACACATTCTATGTGAACTCGAGTTCACATAGAATGTGTCTGACTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000327765    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006223.2-313s21c1
Sequence:CCGGCCGCACAGTATAGTGAAGATACTCGAGTATCTTCACTATACTGTGCGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000312558    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006223.2-791s21c1
Sequence:CCGGCTCTCAGTCTGTCCCATAAATCTCGAGATTTATGGGACAGACTGAGAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000349737    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006223.2-78s21c1
Sequence:CCGGGAGCGGTTCAGCGTTCAACAACTCGAGTTGTTGAACGCTGAACCGCTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049218    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006223.2-313s1c1
Sequence:CCGGCCGCACAGTATAGTGAAGATACTCGAGTATCTTCACTATACTGTGCGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049219    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006223.2-219s1c1
Sequence:CCGGGCAGTAAAGGTCAGACACATTCTCGAGAATGTGTCTGACCTTTACTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049220    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006223.2-413s1c1
Sequence:CCGGGCCTGTAAGTGGGATGGATAACTCGAGTTATCCATCCCACTTACAGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049222    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006223.2-228s1c1
Sequence:CCGGGTCAGACACATTCTATGTGAACTCGAGTTCACATAGAATGTGTCTGACTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049221    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006223.2-81s1c1
Sequence:CCGGCGGTTCAGCGTTCAACAACAACTCGAGTTGTTGTTGAACGCTGAACCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000327792    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006223.2-413s21c1
Sequence:CCGGGCCTGTAAGTGGGATGGATAACTCGAGTTATCCATCCCACTTACAGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)