EMAIL THIS PAGE TO A FRIEND

PINK1

PTEN induced putative kinase 1

87 Gene Product Result for
Synonyms: BRPK PARK6
UniProtKB ID: Q9BXM7, Q8N6T9, Q8NBU3, Q96DE4
Gene ID:
Human(65018) Summary: This gene encodes a serine/threonine protein kinase that localizes to mitochondria. It is thought to protect cells from stress-induced mitochondrial dysfunction. Mutations in this gene cause one form of autosomal recessive early-onset Parkinson disease. [provided by RefSeq, Jul 2008]
Mouse(68943) PTEN induced putative kinase 1
Rat(298575) PTEN induced putative kinase 1
fruit fly(31607) PTEN-induced putative kinase 1
chicken(425370) PTEN induced putative kinase 1
dog(100688445) PTEN induced putative kinase 1
Horse(100071784) PTEN induced putative kinase 1
domestic cat(101093033) PTEN induced putative kinase 1
Zebrafish(494085) PTEN induced putative kinase 1
cow(510683) PTEN induced putative kinase 1
sheep(101102131) PTEN induced putative kinase 1
naked mole-rat(101716045) PTEN induced putative kinase 1
domestic guinea pig(100720253) PTEN induced putative kinase 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1300802 Anti-Drosophila Park6 (C-term) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution Drosophila
ELISA pricing
SAB1300801 Anti-Drosophila Park6 (N-term) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution Drosophila
ELISA pricing
P0051 Anti-PINK1 (N-terminal region) antibody produced in rabbit ~1.5 mg/mL, affinity isolated antibody, buffered aqueous solution Antibody Enhanced Validation human
western blot pricing
P0075 Anti-PINK1 (N-terminal) antibody produced in rabbit ~1.5 mg/mL, affinity isolated antibody, buffered aqueous solution Antibody Enhanced Validation human
western blot pricing
SAB1306014 ANTI-PINK1 (PARK6) (CENTER) antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human, mouse
western blot pricing
SAB1306335 ANTI-PINK1 (PARK6) (N-TERM T133) antibody produced in rabbit purified immunoglobulin, buffered aqueous solution mouse, human
immunohistochemistry, western blot pricing
SAB2500794 Anti-PINK1 antibody produced in goat affinity isolated antibody, buffered aqueous solution rat
ELISA, western blot pricing
P0076 Anti-PINK1 antibody produced in rabbit ~1.5 mg/mL, affinity isolated antibody, buffered aqueous solution rat (predicted), human, mouse (predicted)
western blot pricing
HPA001931 Anti-PINK1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
SAB1411280 Anti-PINK1 antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human
western blot pricing
MABN505 Anti-Pink1 Antibody, clone N4/15 clone N4/15, from mouse rat, human
western blot pricing
MABN18 Anti-PINK1 Antibody, clone N4/49 clone N4/49, from mouse human
immunohistochemistry, western blot pricing
FCMAB289A4 Milli-Mark Anti-PINK1-Alexa Fluor 488 Antibody, clone N4/49 clone N4/49, Milli-Mark®, from mouse human
flow cytometry pricing
SAB5201275 Monoclonal Anti-Pink1 - Alkaline Phosphatase antibody produced in mouse clone S4-15, purified immunoglobulin human, rat, mouse
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201276 Monoclonal Anti-Pink1 - Apc antibody produced in mouse clone S4-15, purified immunoglobulin mouse, human, rat
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201267 Monoclonal Anti-Pink1 - Atto 390 antibody produced in mouse clone S4-15, purified immunoglobulin human, mouse, rat
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201268 Monoclonal Anti-Pink1 - Atto 488 antibody produced in mouse clone S4-15, purified immunoglobulin mouse, human, rat
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201269 Monoclonal Anti-Pink1 - Atto 565 antibody produced in mouse clone S4-15, purified immunoglobulin human, mouse, rat
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201270 Monoclonal Anti-Pink1 - Atto 594 antibody produced in mouse clone S4-15, purified immunoglobulin human, mouse, rat
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201271 Monoclonal Anti-Pink1 - Atto 633 antibody produced in mouse clone S4-15, purified immunoglobulin mouse, rat, human
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201272 Monoclonal Anti-Pink1 - Atto 655 antibody produced in mouse clone S4-15, purified immunoglobulin mouse, human, rat
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201273 Monoclonal Anti-Pink1 - Atto 680 antibody produced in mouse clone S4-15, purified immunoglobulin mouse, human, rat
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201274 Monoclonal Anti-Pink1 - Atto 700 antibody produced in mouse clone S4-15, purified immunoglobulin human, mouse, rat
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201277 Monoclonal Anti-Pink1 - Biotin antibody produced in mouse clone S4-15, purified immunoglobulin rat, human, mouse
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201278 Monoclonal Anti-Pink1 - Fitc antibody produced in mouse clone S4-15, purified immunoglobulin human, rat, mouse
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201279 Monoclonal Anti-Pink1 - Hrp antibody produced in mouse clone S4-15, purified immunoglobulin rat, human, mouse
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201280 Monoclonal Anti-Pink1 - Pe/Atto 594 antibody produced in mouse clone S4-15, purified immunoglobulin mouse, rat, human
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201281 Monoclonal Anti-Pink1 - Percp antibody produced in mouse clone S4-15, purified immunoglobulin human, mouse, rat
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201282 Monoclonal Anti-Pink1 - Rpe antibody produced in mouse clone S4-15, purified immunoglobulin rat, mouse, human
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201283 Monoclonal Anti-Pink1 - Streptavidin antibody produced in mouse clone S4-15, purified immunoglobulin human, rat, mouse
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201266 Monoclonal Anti-Pink1 antibody produced in mouse clone S4-15, purified immunoglobulin rat, human, mouse
immunocytochemistry, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032409 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032409 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032409 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026880 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026880 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026880 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032409 siRNAs that have been validated in the lab human pricing
NM_001106694 Rosetta Predictions rat pricing
NM_026880 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032409 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00022856 validated 1420
1 SASI_Hs01_00022855 validated 1599
2 SASI_Hs01_00022858 predicted 1980
3 SASI_Hs01_00022859 predicted 737
4 SASI_Hs01_00022860 predicted 1420
5 SASI_Hs02_00359803 predicted 1727
6 SASI_Hs01_00022861 predicted 1603
7 SASI_Hs01_00022862 predicted 1536
8 SASI_Hs01_00022863 predicted 636
9 SASI_Hs02_00359804 predicted 1689
10 SASI_Hs01_00022854 predicted 2324
11 SASI_Hs01_00022857 predicted 878
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106694 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00221468 predicted 522
2 SASI_Rn02_00221469 predicted 861
3 SASI_Rn02_00221470 predicted 755
4 SASI_Rn02_00221471 predicted 814
5 SASI_Rn02_00221472 predicted 889
6 SASI_Rn02_00221473 predicted 581
7 SASI_Rn02_00221474 predicted 803
8 SASI_Rn02_00221475 predicted 822
9 SASI_Rn02_00221476 predicted 584
10 SASI_Rn02_00221477 predicted 878
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026880 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00331134 predicted 1974
2 SASI_Mm02_00331135 predicted 1874
3 SASI_Mm01_00041064 predicted 630
4 SASI_Mm01_00041065 predicted 2030
5 SASI_Mm02_00331136 predicted 2108
6 SASI_Mm01_00041066 predicted 2109
7 SASI_Mm01_00041067 predicted 564
8 SASI_Mm01_00041068 predicted 2103
9 SASI_Mm01_00041069 predicted 1150
10 SASI_Mm02_00331137 predicted 1352
11 SASI_Mm01_00041070 predicted 1375
12 SASI_Mm01_00041071 predicted 1843
13 SASI_Mm01_00041072 predicted 803
14 SASI_Mm01_00041073 predicted 925
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032409
VALIDATED
PINK1 MISSION shRNA Bacterial Glycerol Stock
PTEN induced putative kinase 1
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000007101    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_032409.1-548s1c1
Sequence:CCGGCGGCTGGAGGAGTATCTGATACTCGAGTATCAGATACTCCTCCAGCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197083    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032409.1-785s1c1
Sequence:CCGGGAAGCCATCTTGAACACAATGCTCGAGCATTGTGTTCAAGATGGCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199193    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_032409.1-1028s1c1
Sequence:CCGGCGGACGCTGTTCCTCGTTATGCTCGAGCATAACGAGGAACAGCGTCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199746    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032409.1-1880s1c1
Sequence:CCGGGCATCCTCTGTGTCGTGATGGCTCGAGCCATCACGACACAGAGGATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196758    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032409.1-2473s1c1
Sequence:CCGGGTATGTGCCTTGAACTGAATACTCGAGTATTCAGTTCAAGGCACATACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199255    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_032409.1-284s1c1
Sequence:CCGGCCTAACCGTCTCCGCTTCTTCCTCGAGGAAGAAGCGGAGACGGTTAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199446    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_032409.1-608s1c1
Sequence:CCGGGAAGCCACCATGCCTACATTGCTCGAGCAATGTAGGCATGGTGGCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032409
VALIDATED
PINK1 MISSION shRNA shRNA Plasmid DNA
PTEN induced putative kinase 1
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000007101    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_032409.1-548s1c1
Sequence:CCGGCGGCTGGAGGAGTATCTGATACTCGAGTATCAGATACTCCTCCAGCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000197083    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032409.1-785s1c1
Sequence:CCGGGAAGCCATCTTGAACACAATGCTCGAGCATTGTGTTCAAGATGGCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199193    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_032409.1-1028s1c1
Sequence:CCGGCGGACGCTGTTCCTCGTTATGCTCGAGCATAACGAGGAACAGCGTCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199746    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032409.1-1880s1c1
Sequence:CCGGGCATCCTCTGTGTCGTGATGGCTCGAGCCATCACGACACAGAGGATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196758    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032409.1-2473s1c1
Sequence:CCGGGTATGTGCCTTGAACTGAATACTCGAGTATTCAGTTCAAGGCACATACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199255    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_032409.1-284s1c1
Sequence:CCGGCCTAACCGTCTCCGCTTCTTCCTCGAGGAAGAAGCGGAGACGGTTAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199446    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_032409.1-608s1c1
Sequence:CCGGGAAGCCACCATGCCTACATTGCTCGAGCAATGTAGGCATGGTGGCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032409
VALIDATED
PINK1 MISSION shRNA Lentiviral Transduction Particles
PTEN induced putative kinase 1
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000007101    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_032409.1-548s1c1
Sequence:CCGGCGGCTGGAGGAGTATCTGATACTCGAGTATCAGATACTCCTCCAGCCGTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000197083    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032409.1-785s1c1
Sequence:CCGGGAAGCCATCTTGAACACAATGCTCGAGCATTGTGTTCAAGATGGCTTCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000199193    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_032409.1-1028s1c1
Sequence:CCGGCGGACGCTGTTCCTCGTTATGCTCGAGCATAACGAGGAACAGCGTCCGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000199746    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032409.1-1880s1c1
Sequence:CCGGGCATCCTCTGTGTCGTGATGGCTCGAGCCATCACGACACAGAGGATGCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000196758    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032409.1-2473s1c1
Sequence:CCGGGTATGTGCCTTGAACTGAATACTCGAGTATTCAGTTCAAGGCACATACTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000199255    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_032409.1-284s1c1
Sequence:CCGGCCTAACCGTCTCCGCTTCTTCCTCGAGGAAGAAGCGGAGACGGTTAGGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000199446    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_032409.1-608s1c1
Sequence:CCGGGAAGCCACCATGCCTACATTGCTCGAGCAATGTAGGCATGGTGGCTTCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026880
VALIDATED
PINK1 MISSION shRNA Bacterial Glycerol Stock
PTEN induced putative kinase 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000026743    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026880.1-1331s1c1
Sequence:CCGGGCGGTAATTGACTACAGCAAACTCGAGTTTGCTGTAGTCAATTACCGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026750    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026880.1-925s1c1
Sequence:CCGGCCTGGCTGACTATCCTGATATCTCGAGATATCAGGATAGTCAGCCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026727    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026880.1-1559s1c1
Sequence:CCGGGCTGCAAATGTGCTGCACTTACTCGAGTAAGTGCAGCACATTTGCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026742    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026880.1-515s1c1
Sequence:CCGGGAGGATTATCTGATAGGGCAACTCGAGTTGCCCTATCAGATAATCCTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026733    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026880.1-1379s1c1
Sequence:CCGGGCCTATGAAATCTTTGGGCTTCTCGAGAAGCCCAAAGATTTCATAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350677    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026880.2-1581s21c1
Sequence:CCGGGCTGCAAATGTGCTGCACTTACTCGAGTAAGTGCAGCACATTTGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322198    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026880.2-2180s21c1
Sequence:CCGGGAACTTTGCTTGTCGTCAATACTCGAGTATTGACGACAAGCAAAGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322262    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026880.2-947s21c1
Sequence:CCGGCCTGGCTGACTATCCTGATATCTCGAGATATCAGGATAGTCAGCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322263    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026880.2-1353s21c1
Sequence:CCGGGCGGTAATTGACTACAGCAAACTCGAGTTTGCTGTAGTCAATTACCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026880
VALIDATED
PINK1 MISSION shRNA shRNA Plasmid DNA
PTEN induced putative kinase 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000026743    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026880.1-1331s1c1
Sequence:CCGGGCGGTAATTGACTACAGCAAACTCGAGTTTGCTGTAGTCAATTACCGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026750    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026880.1-925s1c1
Sequence:CCGGCCTGGCTGACTATCCTGATATCTCGAGATATCAGGATAGTCAGCCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026727    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026880.1-1559s1c1
Sequence:CCGGGCTGCAAATGTGCTGCACTTACTCGAGTAAGTGCAGCACATTTGCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026742    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026880.1-515s1c1
Sequence:CCGGGAGGATTATCTGATAGGGCAACTCGAGTTGCCCTATCAGATAATCCTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026733    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026880.1-1379s1c1
Sequence:CCGGGCCTATGAAATCTTTGGGCTTCTCGAGAAGCCCAAAGATTTCATAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000350677    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026880.2-1581s21c1
Sequence:CCGGGCTGCAAATGTGCTGCACTTACTCGAGTAAGTGCAGCACATTTGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000322198    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026880.2-2180s21c1
Sequence:CCGGGAACTTTGCTTGTCGTCAATACTCGAGTATTGACGACAAGCAAAGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000322262    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026880.2-947s21c1
Sequence:CCGGCCTGGCTGACTATCCTGATATCTCGAGATATCAGGATAGTCAGCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000322263    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026880.2-1353s21c1
Sequence:CCGGGCGGTAATTGACTACAGCAAACTCGAGTTTGCTGTAGTCAATTACCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026880
VALIDATED
PINK1 MISSION shRNA Lentiviral Transduction Particles
PTEN induced putative kinase 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000026743    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026880.1-1331s1c1
Sequence:CCGGGCGGTAATTGACTACAGCAAACTCGAGTTTGCTGTAGTCAATTACCGCTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000026750    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026880.1-925s1c1
Sequence:CCGGCCTGGCTGACTATCCTGATATCTCGAGATATCAGGATAGTCAGCCAGGTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000026727    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026880.1-1559s1c1
Sequence:CCGGGCTGCAAATGTGCTGCACTTACTCGAGTAAGTGCAGCACATTTGCAGCTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000026742    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026880.1-515s1c1
Sequence:CCGGGAGGATTATCTGATAGGGCAACTCGAGTTGCCCTATCAGATAATCCTCTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000026733    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026880.1-1379s1c1
Sequence:CCGGGCCTATGAAATCTTTGGGCTTCTCGAGAAGCCCAAAGATTTCATAGGCTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000350677    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026880.2-1581s21c1
Sequence:CCGGGCTGCAAATGTGCTGCACTTACTCGAGTAAGTGCAGCACATTTGCAGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000322198    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026880.2-2180s21c1
Sequence:CCGGGAACTTTGCTTGTCGTCAATACTCGAGTATTGACGACAAGCAAAGTTCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000322262    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026880.2-947s21c1
Sequence:CCGGCCTGGCTGACTATCCTGATATCTCGAGATATCAGGATAGTCAGCCAGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000322263    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026880.2-1353s21c1
Sequence:CCGGGCGGTAATTGACTACAGCAAACTCGAGTTTGCTGTAGTCAATTACCGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???