EMAIL THIS PAGE TO A FRIEND

PINLYP

phospholipase A2 inhibitor and LY6/PLAUR domain containing

60 Gene Product Result for
UniProtKB ID: A6NC86, B7Z457, O95053
Gene ID:
Mouse(641361) phospholipase A2 inhibitor and LY6/PLAUR domain containing
Rat(308429) phospholipase A2 inhibitor and LY6/PLAUR domain containing
chicken(426893) phospholipase A2 inhibitor and LY6/PLAUR domain containing
domestic guinea pig(100714643) phospholipase A2 inhibitor and LY6/PLAUR domain containing
naked mole-rat(101702665) phospholipase A2 inhibitor and LY6/PLAUR domain containing
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001037143 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001037143 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001037143 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU209481 MISSION® esiRNA esiRNA targeting mouse 2310033E01Rik mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001129773 Rosetta Predictions human pricing
XM_001131816 Rosetta Predictions human pricing
XM_001724340 Rosetta Predictions human pricing
NM_001107488 Rosetta Predictions rat pricing
NM_001037143 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001129773 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00386549 predicted 327
2 SASI_Hs02_00386550 predicted 396
3 SASI_Hs02_00386551 predicted 396
4 SASI_Hs02_00386552 predicted 413
5 SASI_Hs02_00386553 predicted 367
6 SASI_Hs02_00386554 predicted 251
7 SASI_Hs02_00386555 predicted 335
8 SASI_Hs02_00386556 predicted 456
9 SASI_Hs02_00386557 predicted 289
10 SASI_Hs02_00386558 predicted 416
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001131816 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00388678 predicted 328
2 SASI_Hs02_00388679 predicted 390
3 SASI_Hs02_00388680 predicted 395
4 SASI_Hs02_00388681 predicted 411
5 SASI_Hs02_00388682 predicted 364
6 SASI_Hs02_00388683 predicted 256
7 SASI_Hs02_00388684 predicted 336
8 SASI_Hs02_00388685 predicted 453
9 SASI_Hs02_00388686 predicted 289
10 SASI_Hs02_00388687 predicted 410
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001724340 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00461090 predicted 327
2 SASI_Hs02_00461091 predicted 393
3 SASI_Hs02_00461092 predicted 412
4 SASI_Hs02_00461093 predicted 368
5 SASI_Hs02_00461094 predicted 288
6 SASI_Hs02_00461095 predicted 255
7 SASI_Hs02_00461096 predicted 335
8 SASI_Hs02_00461097 predicted 461
9 SASI_Hs02_00461098 predicted 283
10 SASI_Hs02_00461099 predicted 412
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107488 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00229325 predicted 455
2 SASI_Rn02_00229326 predicted 487
3 SASI_Rn02_00229327 predicted 454
4 SASI_Rn02_00229328 predicted 481
5 SASI_Rn02_00229329 predicted 479
6 SASI_Rn02_00229330 predicted 201
7 SASI_Rn02_00229331 predicted 489
8 SASI_Rn02_00229332 predicted 364
9 SASI_Rn02_00229333 predicted 273
10 SASI_Rn02_00229334 predicted 243
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037143 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00150100 predicted 447
2 SASI_Mm01_00150101 predicted 456
3 SASI_Mm02_00289288 predicted 373
4 SASI_Mm01_00150102 predicted 281
5 SASI_Mm01_00150104 predicted 249
6 SASI_Mm01_00150105 predicted 486
7 SASI_Mm01_00150106 predicted 487
8 SASI_Mm01_00150107 predicted 246
9 SASI_Mm01_00150108 predicted 213
10 SASI_Mm01_00150109 predicted 369
11 SASI_Mm01_00150103 predicted 316
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001037143
PINLYP MISSION shRNA Bacterial Glycerol Stock
phospholipase A2 inhibitor and LY6/PLAUR domain containing
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000269591    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037143.2-496s21c1
Sequence:CCGGGGTATTATCCACACGAAATTTCTCGAGAAATTTCGTGTGGATAATACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000269590    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037143.2-227s21c1
Sequence:CCGGAGGCCTGCATGAAGTACAAAGCTCGAGCTTTGTACTTCATGCAGGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000269527    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037143.2-251s21c1
Sequence:CCGGGCTACTCAGGCTTCGTATCAACTCGAGTTGATACGAAGCCTGAGTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000269582    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037143.2-143s21c1
Sequence:CCGGAGACCTGTGAAGACGGCAAAGCTCGAGCTTTGCCGTCTTCACAGGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000269526    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037143.2-455s21c1
Sequence:CCGGGGGAAACACACTGCATCTATTCTCGAGAATAGATGCAGTGTGTTTCCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001037143
PINLYP MISSION shRNA shRNA Plasmid DNA
phospholipase A2 inhibitor and LY6/PLAUR domain containing
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000269591    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037143.2-496s21c1
Sequence:CCGGGGTATTATCCACACGAAATTTCTCGAGAAATTTCGTGTGGATAATACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000269590    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037143.2-227s21c1
Sequence:CCGGAGGCCTGCATGAAGTACAAAGCTCGAGCTTTGTACTTCATGCAGGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000269527    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037143.2-251s21c1
Sequence:CCGGGCTACTCAGGCTTCGTATCAACTCGAGTTGATACGAAGCCTGAGTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000269582    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037143.2-143s21c1
Sequence:CCGGAGACCTGTGAAGACGGCAAAGCTCGAGCTTTGCCGTCTTCACAGGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000269526    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037143.2-455s21c1
Sequence:CCGGGGGAAACACACTGCATCTATTCTCGAGAATAGATGCAGTGTGTTTCCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001037143
PINLYP MISSION shRNA Lentiviral Transduction Particles
phospholipase A2 inhibitor and LY6/PLAUR domain containing
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000269591    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037143.2-496s21c1
Sequence:CCGGGGTATTATCCACACGAAATTTCTCGAGAAATTTCGTGTGGATAATACCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000269590    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037143.2-227s21c1
Sequence:CCGGAGGCCTGCATGAAGTACAAAGCTCGAGCTTTGTACTTCATGCAGGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000269527    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037143.2-251s21c1
Sequence:CCGGGCTACTCAGGCTTCGTATCAACTCGAGTTGATACGAAGCCTGAGTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000269582    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037143.2-143s21c1
Sequence:CCGGAGACCTGTGAAGACGGCAAAGCTCGAGCTTTGCCGTCTTCACAGGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000269526    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037143.2-455s21c1
Sequence:CCGGGGGAAACACACTGCATCTATTCTCGAGAATAGATGCAGTGTGTTTCCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)