EMAIL THIS PAGE TO A FRIEND

PINX1

PIN2/TERF1 interacting, telomerase inhibitor 1

78 Gene Product Result for
Synonyms: LPTL LPTS
Gene ID:
Mouse(72400) PIN2/TERF1 interacting, telomerase inhibitor 1
Rat(305963) PIN2/TERF1 interacting, telomerase inhibitor 1
Zebrafish(368253) pin2/trf1-interacting protein 1
chicken(422028) PIN2/TERF1 interacting, telomerase inhibitor 1
dog(607910) PIN2/TERF1 interacting, telomerase inhibitor 1
cow(525027) PIN2/TERF1 interacting, telomerase inhibitor 1
sheep(101110656) PIN2/TERF1 interacting, telomerase inhibitor 1
naked mole-rat(101704333) PIN2/TERF1 interacting, telomerase inhibitor 1
domestic guinea pig(100717616) PIN2/TERF1 interacting, telomerase inhibitor 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_017884 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017884 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017884 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_028228 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028228 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028228 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017884 Rosetta Predictions human pricing
NM_001083337 Rosetta Predictions rat pricing
NM_028228 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017884 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00350828 predicted 690
2 SASI_Hs01_00069784 predicted 685
3 SASI_Hs02_00350829 predicted 287
4 SASI_Hs01_00069785 predicted 301
5 SASI_Hs01_00069790 predicted 610
6 SASI_Hs01_00069786 predicted 697
7 SASI_Hs01_00069787 predicted 684
8 SASI_Hs01_00069788 predicted 619
9 SASI_Hs02_00350830 predicted 521
10 SASI_Hs02_00350831 predicted 554
11 SASI_Hs01_00069789 predicted 365
12 SASI_Hs01_00069791 predicted 336
13 SASI_Hs01_00069792 predicted 430
14 SASI_Hs01_00069793 predicted 272
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001083337 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00208869 predicted 302
2 SASI_Rn02_00208870 predicted 393
3 SASI_Rn02_00208871 predicted 228
4 SASI_Rn02_00208872 predicted 363
5 SASI_Rn02_00208873 predicted 218
6 SASI_Rn02_00208874 predicted 200
7 SASI_Rn02_00208875 predicted 290
8 SASI_Rn02_00208876 predicted 362
9 SASI_Rn02_00208877 predicted 203
10 SASI_Rn02_00208878 predicted 274
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028228 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00085044 predicted 950
2 SASI_Mm01_00085045 predicted 357
3 SASI_Mm01_00085046 predicted 340
4 SASI_Mm01_00085047 predicted 461
5 SASI_Mm01_00085048 predicted 458
6 SASI_Mm01_00085049 predicted 254
7 SASI_Mm01_00085051 predicted 289
8 SASI_Mm01_00085052 predicted 287
9 SASI_Mm02_00333553 predicted 988
10 SASI_Mm01_00085053 predicted 207
11 SASI_Mm01_00085050 predicted 213
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017884
VALIDATED
PINX1 MISSION shRNA Bacterial Glycerol Stock
PIN2/TERF1 interacting, telomerase inhibitor 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000275698    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_017884.4-643s21c1
Sequence:CCGGGAGACGCAGGTGGAACGTAAACTCGAGTTTACGTTCCACCTGCGTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275728    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_017884.4-560s21c1
Sequence:CCGGTCACCATCCAGGAGTACTTTGCTCGAGCAAAGTACTCCTGGATGGTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275654    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_017884.4-330s21c1
Sequence:CCGGCACAGATTCCTCGGACAAGAACTCGAGTTCTTGTCCGAGGAATCTGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275656    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_017884.4-398s21c1
Sequence:CCGGACCGTGTTCACTATATGAAATCTCGAGATTTCATATAGTGAACACGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275726    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017884.4-230s21c1
Sequence:CCGGGACTCGGAGCTACCATCAATACTCGAGTATTGATGGTAGCTCCGAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129771    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017884.3-1364s1c1
Sequence:CCGGCCTTCAGCAAGAGAGTTTAATCTCGAGATTAAACTCTCTTGCTGAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017884.3-279s1c1
Sequence:CCGGGCAAGGAGCCACAGATCATATCTCGAGATATGATCTGTGGCTCCTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128117    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_017884.3-429s1c1
Sequence:CCGGCACAGATTCCTCGGACAAGAACTCGAGTTCTTGTCCGAGGAATCTGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129084    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017884.3-1066s1c1
Sequence:CCGGGCTACACTAGAAGAAACGCTACTCGAGTAGCGTTTCTTCTAGTGTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128607    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017884.3-791s1c1
Sequence:CCGGCAGGTAAAGATGTGGAAAGTTCTCGAGAACTTTCCACATCTTTACCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017884
VALIDATED
PINX1 MISSION shRNA shRNA Plasmid DNA
PIN2/TERF1 interacting, telomerase inhibitor 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000275698    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_017884.4-643s21c1
Sequence:CCGGGAGACGCAGGTGGAACGTAAACTCGAGTTTACGTTCCACCTGCGTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000275728    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_017884.4-560s21c1
Sequence:CCGGTCACCATCCAGGAGTACTTTGCTCGAGCAAAGTACTCCTGGATGGTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000275654    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_017884.4-330s21c1
Sequence:CCGGCACAGATTCCTCGGACAAGAACTCGAGTTCTTGTCCGAGGAATCTGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000275656    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_017884.4-398s21c1
Sequence:CCGGACCGTGTTCACTATATGAAATCTCGAGATTTCATATAGTGAACACGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000275726    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017884.4-230s21c1
Sequence:CCGGGACTCGGAGCTACCATCAATACTCGAGTATTGATGGTAGCTCCGAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129771    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017884.3-1364s1c1
Sequence:CCGGCCTTCAGCAAGAGAGTTTAATCTCGAGATTAAACTCTCTTGCTGAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017884.3-279s1c1
Sequence:CCGGGCAAGGAGCCACAGATCATATCTCGAGATATGATCTGTGGCTCCTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128117    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_017884.3-429s1c1
Sequence:CCGGCACAGATTCCTCGGACAAGAACTCGAGTTCTTGTCCGAGGAATCTGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129084    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017884.3-1066s1c1
Sequence:CCGGGCTACACTAGAAGAAACGCTACTCGAGTAGCGTTTCTTCTAGTGTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128607    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017884.3-791s1c1
Sequence:CCGGCAGGTAAAGATGTGGAAAGTTCTCGAGAACTTTCCACATCTTTACCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017884
VALIDATED
PINX1 MISSION shRNA Lentiviral Transduction Particles
PIN2/TERF1 interacting, telomerase inhibitor 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000275698    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_017884.4-643s21c1
Sequence:CCGGGAGACGCAGGTGGAACGTAAACTCGAGTTTACGTTCCACCTGCGTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275728    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_017884.4-560s21c1
Sequence:CCGGTCACCATCCAGGAGTACTTTGCTCGAGCAAAGTACTCCTGGATGGTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275654    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_017884.4-330s21c1
Sequence:CCGGCACAGATTCCTCGGACAAGAACTCGAGTTCTTGTCCGAGGAATCTGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275656    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_017884.4-398s21c1
Sequence:CCGGACCGTGTTCACTATATGAAATCTCGAGATTTCATATAGTGAACACGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275726    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017884.4-230s21c1
Sequence:CCGGGACTCGGAGCTACCATCAATACTCGAGTATTGATGGTAGCTCCGAGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129771    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017884.3-1364s1c1
Sequence:CCGGCCTTCAGCAAGAGAGTTTAATCTCGAGATTAAACTCTCTTGCTGAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017884.3-279s1c1
Sequence:CCGGGCAAGGAGCCACAGATCATATCTCGAGATATGATCTGTGGCTCCTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128117    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_017884.3-429s1c1
Sequence:CCGGCACAGATTCCTCGGACAAGAACTCGAGTTCTTGTCCGAGGAATCTGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129084    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017884.3-1066s1c1
Sequence:CCGGGCTACACTAGAAGAAACGCTACTCGAGTAGCGTTTCTTCTAGTGTAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128607    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017884.3-791s1c1
Sequence:CCGGCAGGTAAAGATGTGGAAAGTTCTCGAGAACTTTCCACATCTTTACCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028228
VALIDATED
PINX1 MISSION shRNA Bacterial Glycerol Stock
PIN2/TERF1 interacting, telomerase inhibitor 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000071227    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_028228.1-431s1c1
Sequence:CCGGCCGGGTTCATTATATGAAATTCTCGAGAATTTCATATAATGAACCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071226    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_028228.1-999s1c1
Sequence:CCGGGTAGAAATAGACGCCACACTACTCGAGTAGTGTGGCGTCTATTTCTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071225    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_028228.1-179s1c1
Sequence:CCGGGTGGTCTAAAGGAAAGGGTTTCTCGAGAAACCCTTTCCTTTAGACCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071223    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_028228.1-630s1c1
Sequence:CCGGGCCAAGAGAATGGCCCAATTACTCGAGTAATTGGGCCATTCTCTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071224    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028228.1-606s1c1
Sequence:CCGGGCCTTCACCATCCAGGAATATCTCGAGATATTCCTGGATGGTGAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028228
VALIDATED
PINX1 MISSION shRNA shRNA Plasmid DNA
PIN2/TERF1 interacting, telomerase inhibitor 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000071227    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_028228.1-431s1c1
Sequence:CCGGCCGGGTTCATTATATGAAATTCTCGAGAATTTCATATAATGAACCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071226    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_028228.1-999s1c1
Sequence:CCGGGTAGAAATAGACGCCACACTACTCGAGTAGTGTGGCGTCTATTTCTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071225    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_028228.1-179s1c1
Sequence:CCGGGTGGTCTAAAGGAAAGGGTTTCTCGAGAAACCCTTTCCTTTAGACCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071223    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_028228.1-630s1c1
Sequence:CCGGGCCAAGAGAATGGCCCAATTACTCGAGTAATTGGGCCATTCTCTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071224    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028228.1-606s1c1
Sequence:CCGGGCCTTCACCATCCAGGAATATCTCGAGATATTCCTGGATGGTGAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028228
VALIDATED
PINX1 MISSION shRNA Lentiviral Transduction Particles
PIN2/TERF1 interacting, telomerase inhibitor 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000071227    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_028228.1-431s1c1
Sequence:CCGGCCGGGTTCATTATATGAAATTCTCGAGAATTTCATATAATGAACCCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071226    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_028228.1-999s1c1
Sequence:CCGGGTAGAAATAGACGCCACACTACTCGAGTAGTGTGGCGTCTATTTCTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071225    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_028228.1-179s1c1
Sequence:CCGGGTGGTCTAAAGGAAAGGGTTTCTCGAGAAACCCTTTCCTTTAGACCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071223    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_028228.1-630s1c1
Sequence:CCGGGCCAAGAGAATGGCCCAATTACTCGAGTAATTGGGCCATTCTCTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071224    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028228.1-606s1c1
Sequence:CCGGGCCTTCACCATCCAGGAATATCTCGAGATATTCCTGGATGGTGAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)