EMAIL THIS PAGE TO A FRIEND

PIP4K2A

phosphatidylinositol-5-phosphate 4-kinase, type II, alpha

65 Gene Product Result for
Synonyms: PI5P4KA PIP5K2A PIP5KII-alpha PIP5KIIA PIPK
UniProtKB ID: P48426, B0YJ66, D3DRV1, P53807, Q5VUX3
Gene ID:
Human(5305) Summary: Phosphatidylinositol-5,4-bisphosphate, the precursor to second messengers of the phosphoinositide signal transduction pathways, is thought to be involved in the regulation of secretion, cell proliferation, differentiation, and motility. The protein encoded by this gene is one of a family of enzymes capable of catalyzing the phosphorylation of phosphatidylinositol-5-phosphate on the fourth hydroxyl of the myo-inositol ring to form phosphatidylinositol-5,4-bisphosphate. The amino acid sequence of this enzyme does not show homology to other kinases, but the recombinant protein does exhibit kinase activity. This gene is a member of the phosphatidylinositol-5-phosphate 4-kinase family. [provided by RefSeq, Jul 2008]
Mouse(18718) phosphatidylinositol-5-phosphate 4-kinase, type II, alpha
Rat(116723) phosphatidylinositol-5-phosphate 4-kinase, type II, alpha
chicken(420504) phosphatidylinositol-5-phosphate 4-kinase, type II, alpha
domestic cat(101096576) phosphatidylinositol-5-phosphate 4-kinase, type II, alpha
Horse(100066733) phosphatidylinositol-5-phosphate 4-kinase, type II, alpha
dog(608414) phosphatidylinositol-5-phosphate 4-kinase, type II, alpha
Domestic Rabbit(100340683) phosphatidylinositol-5-phosphate 4-kinase, type II, alpha
naked mole-rat(101705091) phosphatidylinositol-5-phosphate 4-kinase, type II, alpha
domestic guinea pig(100718003) phosphatidylinositol-5-phosphate 4-kinase, type II, alpha
cow(533289) phosphatidylinositol-5-phosphate 4-kinase, type II, alpha
sheep(101103999) phosphatidylinositol-5-phosphate 4-kinase, type II, alpha
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005028 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005028 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005028 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008845 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008845 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008845 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU021331 MISSION® esiRNA targeting human PIP4K2A human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005028 Rosetta Predictions human pricing
NM_053926 Rosetta Predictions rat pricing
NM_008845 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005028 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00192408 predicted 777
2 SASI_Hs01_00192409 predicted 1299
3 SASI_Hs01_00192410 predicted 814
4 SASI_Hs01_00192411 predicted 847
5 SASI_Hs01_00192412 predicted 1320
6 SASI_Hs01_00192414 predicted 872
7 SASI_Hs01_00192415 predicted 1318
8 SASI_Hs01_00192416 predicted 782
9 SASI_Hs01_00192417 predicted 666
10 SASI_Hs02_00338811 predicted 1190
11 SASI_Hs01_00192413 predicted 398
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053926 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00105088 predicted 570
2 SASI_Rn01_00105090 predicted 1154
3 SASI_Rn01_00105092 predicted 1142
4 SASI_Rn02_00266873 predicted 267
5 SASI_Rn01_00105093 predicted 513
6 SASI_Rn01_00105094 predicted 613
7 SASI_Rn01_00105095 predicted 1135
8 SASI_Rn02_00266874 predicted 284
9 SASI_Rn01_00105096 predicted 383
10 SASI_Rn01_00105097 predicted 629
11 SASI_Rn01_00105089 predicted 662
12 SASI_Rn01_00105091 predicted 282
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008845 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00044773 predicted 644
2 SASI_Mm01_00044774 predicted 304
3 SASI_Mm01_00044775 predicted 684
4 SASI_Mm01_00044776 predicted 812
5 SASI_Mm01_00044777 predicted 1206
6 SASI_Mm01_00044778 predicted 727
7 SASI_Mm01_00044779 predicted 748
8 SASI_Mm01_00044780 predicted 737
9 SASI_Mm02_00314785 predicted 660
10 SASI_Mm02_00314786 predicted 1175
11 SASI_Mm01_00044781 predicted 300
12 SASI_Mm01_00044782 predicted 781
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005028
VALIDATED
PIP4K2A MISSION shRNA Bacterial Glycerol Stock
phosphatidylinositol-5-phosphate 4-kinase, type II, alpha
Human
16 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000194659    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005028.3-482s1c1
Sequence:CCGGCCGAGCCATTTCAAGTTTAAGCTCGAGCTTAAACTTGAAATGGCTCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010988    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005028.3-533s1c1
Sequence:CCGGCGGGAGAGGTTTGGAATTGATCTCGAGATCAATTCCAAACCTCTCCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006010    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005028.3-776s1c1
Sequence:CCGGCGGCTTAATGTTGATGGAGTTCTCGAGAACTCCATCAACATTAAGCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005028.3-1283s1c1
Sequence:CCGGGTGTACTTCATGGCAATTATTCTCGAGAATAATTGCCATGAAGTACACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356493    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_005028.4-671s21c1
Sequence:CCGGATACATCATCAAGACTATTACCTCGAGGTAATAGTCTTGATGATGTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006009    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005028.3-1463s1c1
Sequence:CCGGCCTCGGACAGACATGAACATTCTCGAGAATGTTCATGTCTGTCCGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194807    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005028.3-1234s1c1
Sequence:CCGGCATCGACGTCTATGGAATTAACTCGAGTTAATTCCATAGACGTCGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006012    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005028.3-703s1c1
Sequence:CCGGCCTGAAGAAATACCACCAGTACTCGAGTACTGGTGGTATTTCTTCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195145    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005028.3-1631s1c1
Sequence:CCGGCCAGCATCGTTCTAGCTATTTCTCGAGAAATAGCTAGAACGATGCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195216    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005028.3-1528s1c1
Sequence:CCGGCTCAGTGAAGTACTCATCTTGCTCGAGCAAGATGAGTACTTCACTGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196296    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005028.3-1552s1c1
Sequence:CCGGGAAGCAAACCTCCTTGTTTACCTCGAGGTAAACAAGGAGGTTTGCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196561    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005028.3-1567s1c1
Sequence:CCGGGTTTACATCTTCAGGCCAAGACTCGAGTCTTGGCCTGAAGATGTAAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196936    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005028.3-831s1c1
Sequence:CCGGGCCACCGTTTGTCTGTGTATACTCGAGTATACACAGACAAACGGTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356495    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_005028.4-783s21c1
Sequence:CCGGTTGGGCATGTACCGGCTTAATCTCGAGATTAAGCCGGTACATGCCCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356569    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_005028.4-866s21c1
Sequence:CCGGGTATAGGAAATACGACTTAAACTCGAGTTTAAGTCGTATTTCCTATACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356567    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_005028.4-1246s21c1
Sequence:CCGGATCCGAACATCGACGTCTATGCTCGAGCATAGACGTCGATGTTCGGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005028
VALIDATED
PIP4K2A MISSION shRNA shRNA Plasmid DNA
phosphatidylinositol-5-phosphate 4-kinase, type II, alpha
Human
16 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000194659    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005028.3-482s1c1
Sequence:CCGGCCGAGCCATTTCAAGTTTAAGCTCGAGCTTAAACTTGAAATGGCTCGGTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000010988    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005028.3-533s1c1
Sequence:CCGGCGGGAGAGGTTTGGAATTGATCTCGAGATCAATTCCAAACCTCTCCCGTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000006010    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005028.3-776s1c1
Sequence:CCGGCGGCTTAATGTTGATGGAGTTCTCGAGAACTCCATCAACATTAAGCCGTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000006011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005028.3-1283s1c1
Sequence:CCGGGTGTACTTCATGGCAATTATTCTCGAGAATAATTGCCATGAAGTACACTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000356493    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_005028.4-671s21c1
Sequence:CCGGATACATCATCAAGACTATTACCTCGAGGTAATAGTCTTGATGATGTATTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000006009    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005028.3-1463s1c1
Sequence:CCGGCCTCGGACAGACATGAACATTCTCGAGAATGTTCATGTCTGTCCGAGGTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000194807    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005028.3-1234s1c1
Sequence:CCGGCATCGACGTCTATGGAATTAACTCGAGTTAATTCCATAGACGTCGATGTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000006012    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005028.3-703s1c1
Sequence:CCGGCCTGAAGAAATACCACCAGTACTCGAGTACTGGTGGTATTTCTTCAGGTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000195145    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005028.3-1631s1c1
Sequence:CCGGCCAGCATCGTTCTAGCTATTTCTCGAGAAATAGCTAGAACGATGCTGGTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000195216    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005028.3-1528s1c1
Sequence:CCGGCTCAGTGAAGTACTCATCTTGCTCGAGCAAGATGAGTACTTCACTGAGTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000196296    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005028.3-1552s1c1
Sequence:CCGGGAAGCAAACCTCCTTGTTTACCTCGAGGTAAACAAGGAGGTTTGCTTCTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000196561    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005028.3-1567s1c1
Sequence:CCGGGTTTACATCTTCAGGCCAAGACTCGAGTCTTGGCCTGAAGATGTAAACTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000196936    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005028.3-831s1c1
Sequence:CCGGGCCACCGTTTGTCTGTGTATACTCGAGTATACACAGACAAACGGTGGCTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000356495    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_005028.4-783s21c1
Sequence:CCGGTTGGGCATGTACCGGCTTAATCTCGAGATTAAGCCGGTACATGCCCAATTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000356569    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_005028.4-866s21c1
Sequence:CCGGGTATAGGAAATACGACTTAAACTCGAGTTTAAGTCGTATTTCCTATACTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000356567    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_005028.4-1246s21c1
Sequence:CCGGATCCGAACATCGACGTCTATGCTCGAGCATAGACGTCGATGTTCGGATTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005028
VALIDATED
PIP4K2A MISSION shRNA Lentiviral Transduction Particles
phosphatidylinositol-5-phosphate 4-kinase, type II, alpha
Human
16 Products Total
TRC Number Volume Titer/mL Vector Price Set Price (5+)? Select
TRCN0000194659    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005028.3-482s1c1
Sequence:CCGGCCGAGCCATTTCAAGTTTAAGCTCGAGCTTAAACTTGAAATGGCTCGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010988    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005028.3-533s1c1
Sequence:CCGGCGGGAGAGGTTTGGAATTGATCTCGAGATCAATTCCAAACCTCTCCCGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006010    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005028.3-776s1c1
Sequence:CCGGCGGCTTAATGTTGATGGAGTTCTCGAGAACTCCATCAACATTAAGCCGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005028.3-1283s1c1
Sequence:CCGGGTGTACTTCATGGCAATTATTCTCGAGAATAATTGCCATGAAGTACACTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000356493    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_005028.4-671s21c1
Sequence:CCGGATACATCATCAAGACTATTACCTCGAGGTAATAGTCTTGATGATGTATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006009    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005028.3-1463s1c1
Sequence:CCGGCCTCGGACAGACATGAACATTCTCGAGAATGTTCATGTCTGTCCGAGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194807    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005028.3-1234s1c1
Sequence:CCGGCATCGACGTCTATGGAATTAACTCGAGTTAATTCCATAGACGTCGATGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006012    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005028.3-703s1c1
Sequence:CCGGCCTGAAGAAATACCACCAGTACTCGAGTACTGGTGGTATTTCTTCAGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195145    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005028.3-1631s1c1
Sequence:CCGGCCAGCATCGTTCTAGCTATTTCTCGAGAAATAGCTAGAACGATGCTGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195216    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005028.3-1528s1c1
Sequence:CCGGCTCAGTGAAGTACTCATCTTGCTCGAGCAAGATGAGTACTTCACTGAGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196296    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005028.3-1552s1c1
Sequence:CCGGGAAGCAAACCTCCTTGTTTACCTCGAGGTAAACAAGGAGGTTTGCTTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196561    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005028.3-1567s1c1
Sequence:CCGGGTTTACATCTTCAGGCCAAGACTCGAGTCTTGGCCTGAAGATGTAAACTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196936    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005028.3-831s1c1
Sequence:CCGGGCCACCGTTTGTCTGTGTATACTCGAGTATACACAGACAAACGGTGGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000356495    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_005028.4-783s21c1
Sequence:CCGGTTGGGCATGTACCGGCTTAATCTCGAGATTAAGCCGGTACATGCCCAATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000356569    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_005028.4-866s21c1
Sequence:CCGGGTATAGGAAATACGACTTAAACTCGAGTTTAAGTCGTATTTCCTATACTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000356567    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_005028.4-1246s21c1
Sequence:CCGGATCCGAACATCGACGTCTATGCTCGAGCATAGACGTCGATGTTCGGATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008845
PIP4K2A MISSION shRNA Bacterial Glycerol Stock
phosphatidylinositol-5-phosphate 4-kinase, type II, alpha
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000416303    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008845.4-1780s21c1
Sequence:CCGGGACTTGAAAGATATGAGATTGCTCGAGCAATCTCATATCTTTCAAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415033    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008845.4-662s21c1
Sequence:CCGGTGGGAATGTACCGGCTTAATGCTCGAGCATTAAGCCGGTACATTCCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025578    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008845.2-1158s1c1
Sequence:CCGGCCATGAGAATGCGCCTAGAAACTCGAGTTTCTAGGCGCATTCTCATGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025577    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008845.2-816s1c1
Sequence:CCGGGCTGCCAACTTTAAAGGATAACTCGAGTTATCCTTTAAAGTTGGCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025575    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008845.2-1209s1c1
Sequence:CCGGCCTTACTCATTACGATGCAAACTCGAGTTTGCATCGTAATGAGTAAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008845.2-381s1c1
Sequence:CCGGGCCGAGCCATTTCAAGTTTAACTCGAGTTAAACTTGAAATGGCTCGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432717    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008845.4-1521s21c1
Sequence:CCGGTATTTCCCAGCATCGCTATTTCTCGAGAAATAGCGATGCTGGGAAATATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413070    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008845.4-1633s21c1
Sequence:CCGGGCTTGAATCAGAGCTTGTAACCTCGAGGTTACAAGCTCTGATTCAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425695    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008845.4-1180s21c1
Sequence:CCGGGTATACTTCATGGCGATTATTCTCGAGAATAATCGCCATGAAGTATACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008845
PIP4K2A MISSION shRNA shRNA Plasmid DNA
phosphatidylinositol-5-phosphate 4-kinase, type II, alpha
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000416303    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008845.4-1780s21c1
Sequence:CCGGGACTTGAAAGATATGAGATTGCTCGAGCAATCTCATATCTTTCAAGTCTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000415033    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008845.4-662s21c1
Sequence:CCGGTGGGAATGTACCGGCTTAATGCTCGAGCATTAAGCCGGTACATTCCCATTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000025578    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008845.2-1158s1c1
Sequence:CCGGCCATGAGAATGCGCCTAGAAACTCGAGTTTCTAGGCGCATTCTCATGGTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000025577    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008845.2-816s1c1
Sequence:CCGGGCTGCCAACTTTAAAGGATAACTCGAGTTATCCTTTAAAGTTGGCAGCTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000025575    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008845.2-1209s1c1
Sequence:CCGGCCTTACTCATTACGATGCAAACTCGAGTTTGCATCGTAATGAGTAAGGTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000025576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008845.2-381s1c1
Sequence:CCGGGCCGAGCCATTTCAAGTTTAACTCGAGTTAAACTTGAAATGGCTCGGCTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000432717    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008845.4-1521s21c1
Sequence:CCGGTATTTCCCAGCATCGCTATTTCTCGAGAAATAGCGATGCTGGGAAATATTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000413070    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008845.4-1633s21c1
Sequence:CCGGGCTTGAATCAGAGCTTGTAACCTCGAGGTTACAAGCTCTGATTCAAGCTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000425695    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008845.4-1180s21c1
Sequence:CCGGGTATACTTCATGGCGATTATTCTCGAGAATAATCGCCATGAAGTATACTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008845
PIP4K2A MISSION shRNA Lentiviral Transduction Particles
phosphatidylinositol-5-phosphate 4-kinase, type II, alpha
Mouse
9 Products Total
TRC Number Volume Titer/mL Vector Price Set Price (5+)? Select
TRCN0000416303    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008845.4-1780s21c1
Sequence:CCGGGACTTGAAAGATATGAGATTGCTCGAGCAATCTCATATCTTTCAAGTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415033    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008845.4-662s21c1
Sequence:CCGGTGGGAATGTACCGGCTTAATGCTCGAGCATTAAGCCGGTACATTCCCATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025578    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008845.2-1158s1c1
Sequence:CCGGCCATGAGAATGCGCCTAGAAACTCGAGTTTCTAGGCGCATTCTCATGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025577    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008845.2-816s1c1
Sequence:CCGGGCTGCCAACTTTAAAGGATAACTCGAGTTATCCTTTAAAGTTGGCAGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025575    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008845.2-1209s1c1
Sequence:CCGGCCTTACTCATTACGATGCAAACTCGAGTTTGCATCGTAATGAGTAAGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008845.2-381s1c1
Sequence:CCGGGCCGAGCCATTTCAAGTTTAACTCGAGTTAAACTTGAAATGGCTCGGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000432717    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008845.4-1521s21c1
Sequence:CCGGTATTTCCCAGCATCGCTATTTCTCGAGAAATAGCGATGCTGGGAAATATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413070    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008845.4-1633s21c1
Sequence:CCGGGCTTGAATCAGAGCTTGTAACCTCGAGGTTACAAGCTCTGATTCAAGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425695    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008845.4-1180s21c1
Sequence:CCGGGTATACTTCATGGCGATTATTCTCGAGAATAATCGCCATGAAGTATACTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)