EMAIL THIS PAGE TO A FRIEND

PIP4K2C

phosphatidylinositol-5-phosphate 4-kinase, type II, gamma

197 Gene Product Result for
Synonyms: PIP5K2C
UniProtKB ID: Q8TBX8, B2RDL3, B4DM11, B4DY44, Q9H6N2
Gene ID:
Mouse(117150) phosphatidylinositol-5-phosphate 4-kinase, type II, gamma
Rat(140607) phosphatidylinositol-5-phosphate 4-kinase, type II, gamma
naked mole-rat(101708848) phosphatidylinositol-5-phosphate 4-kinase, type II, gamma
domestic guinea pig(100715261) phosphatidylinositol-5-phosphate 4-kinase, type II, gamma
cow(540005) phosphatidylinositol-5-phosphate 4-kinase, type II, gamma
sheep(101119125) phosphatidylinositol-5-phosphate 4-kinase, type II, gamma
dog(474417) phosphatidylinositol-5-phosphate 4-kinase, type II, gamma
domestic cat(101095026) phosphatidylinositol-5-phosphate 4-kinase, type II, gamma
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_054097 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_054097 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_054097 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_024779 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024779 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024779 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024779 Rosetta Predictions human pricing
NM_080480 Rosetta Predictions rat pricing
NM_054097 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024779 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00166018 predicted 734
2 SASI_Hs01_00166019 predicted 1346
3 SASI_Hs01_00166020 predicted 510
4 SASI_Hs02_00357301 predicted 615
5 SASI_Hs01_00166021 predicted 812
6 SASI_Hs01_00166022 predicted 765
7 SASI_Hs01_00166023 predicted 372
8 SASI_Hs01_00166026 predicted 470
9 SASI_Hs01_00166027 predicted 812
10 SASI_Hs02_00357302 predicted 737
11 SASI_Hs01_00166024 predicted 361
12 SASI_Hs01_00166025 predicted 1111
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080480 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00092715 predicted 416
2 SASI_Rn01_00092716 predicted 426
3 SASI_Rn02_00267235 predicted 481
4 SASI_Rn01_00092717 predicted 572
5 SASI_Rn01_00092718 predicted 794
6 SASI_Rn01_00092719 predicted 817
7 SASI_Rn01_00092720 predicted 633
8 SASI_Rn01_00092721 predicted 1418
9 SASI_Rn01_00092722 predicted 246
10 SASI_Rn01_00092723 predicted 1408
11 SASI_Rn01_00092724 predicted 1104
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_054097 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00147030 predicted 542
2 SASI_Mm01_00147031 predicted 404
3 SASI_Mm01_00147032 predicted 493
4 SASI_Mm01_00147033 predicted 793
5 SASI_Mm01_00147034 predicted 329
6 SASI_Mm01_00147035 predicted 1140
7 SASI_Mm01_00147036 predicted 264
8 SASI_Mm01_00147037 predicted 751
9 SASI_Mm01_00147039 predicted 213
10 SASI_Mm02_00338041 predicted 790
11 SASI_Mm01_00147038 predicted 604
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_054097
VALIDATED
PIP4K2C MISSION shRNA Bacterial Glycerol Stock
phosphatidylinositol-5-phosphate 4-kinase, type II, gamma
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000319779    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054097.2-281s21c1
Sequence:CCGGCTCCAAGATCAAGGTCAACAACTCGAGTTGTTGACCTTGATCTTGGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024702    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054097.2-281s1c1
Sequence:CCGGCTCCAAGATCAAGGTCAACAACTCGAGTTGTTGACCTTGATCTTGGAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024699    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054097.2-508s1c1
Sequence:CCGGCGAGCGAAGATATTGCGGATACTCGAGTATCCGCAATATCTTCGCTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319782    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054097.2-1086s21c1
Sequence:CCGGGAGTCCTTCATCGATGTCTATCTCGAGATAGACATCGATGAAGGACTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024701    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_054097.2-683s1c1
Sequence:CCGGGCATAGGAAGTATGACCTCAACTCGAGTTGAGGTCATACTTCCTATGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024703    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054097.2-1086s1c1
Sequence:CCGGGAGTCCTTCATCGATGTCTATCTCGAGATAGACATCGATGAAGGACTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319781    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054097.2-683s21c1
Sequence:CCGGGCATAGGAAGTATGACCTCAACTCGAGTTGAGGTCATACTTCCTATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319780    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054097.2-508s21c1
Sequence:CCGGCGAGCGAAGATATTGCGGATACTCGAGTATCCGCAATATCTTCGCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_054097
VALIDATED
PIP4K2C MISSION shRNA shRNA Plasmid DNA
phosphatidylinositol-5-phosphate 4-kinase, type II, gamma
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000319779    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054097.2-281s21c1
Sequence:CCGGCTCCAAGATCAAGGTCAACAACTCGAGTTGTTGACCTTGATCTTGGAGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000024702    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054097.2-281s1c1
Sequence:CCGGCTCCAAGATCAAGGTCAACAACTCGAGTTGTTGACCTTGATCTTGGAGTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000024699    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054097.2-508s1c1
Sequence:CCGGCGAGCGAAGATATTGCGGATACTCGAGTATCCGCAATATCTTCGCTCGTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000319782    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054097.2-1086s21c1
Sequence:CCGGGAGTCCTTCATCGATGTCTATCTCGAGATAGACATCGATGAAGGACTCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000024701    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_054097.2-683s1c1
Sequence:CCGGGCATAGGAAGTATGACCTCAACTCGAGTTGAGGTCATACTTCCTATGCTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000024703    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054097.2-1086s1c1
Sequence:CCGGGAGTCCTTCATCGATGTCTATCTCGAGATAGACATCGATGAAGGACTCTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000319781    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054097.2-683s21c1
Sequence:CCGGGCATAGGAAGTATGACCTCAACTCGAGTTGAGGTCATACTTCCTATGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000319780    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054097.2-508s21c1
Sequence:CCGGCGAGCGAAGATATTGCGGATACTCGAGTATCCGCAATATCTTCGCTCGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_054097
VALIDATED
PIP4K2C MISSION shRNA Lentiviral Transduction Particles
phosphatidylinositol-5-phosphate 4-kinase, type II, gamma
Mouse
8 Products Total
TRC Number Volume Titer/mL Vector Price Set Price (5+)? Select
TRCN0000319779    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054097.2-281s21c1
Sequence:CCGGCTCCAAGATCAAGGTCAACAACTCGAGTTGTTGACCTTGATCTTGGAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024702    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054097.2-281s1c1
Sequence:CCGGCTCCAAGATCAAGGTCAACAACTCGAGTTGTTGACCTTGATCTTGGAGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024699    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054097.2-508s1c1
Sequence:CCGGCGAGCGAAGATATTGCGGATACTCGAGTATCCGCAATATCTTCGCTCGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000319782    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054097.2-1086s21c1
Sequence:CCGGGAGTCCTTCATCGATGTCTATCTCGAGATAGACATCGATGAAGGACTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024701    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_054097.2-683s1c1
Sequence:CCGGGCATAGGAAGTATGACCTCAACTCGAGTTGAGGTCATACTTCCTATGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024703    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054097.2-1086s1c1
Sequence:CCGGGAGTCCTTCATCGATGTCTATCTCGAGATAGACATCGATGAAGGACTCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000319781    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054097.2-683s21c1
Sequence:CCGGGCATAGGAAGTATGACCTCAACTCGAGTTGAGGTCATACTTCCTATGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000319780    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054097.2-508s21c1
Sequence:CCGGCGAGCGAAGATATTGCGGATACTCGAGTATCCGCAATATCTTCGCTCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024779
VALIDATED
PIP4K2C MISSION shRNA Bacterial Glycerol Stock
phosphatidylinositol-5-phosphate 4-kinase, type II, gamma
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000199809    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024779.3-177s1c1
Sequence:CCGGGCGTAGCCCACTCGATCAATGCTCGAGCATTGATCGAGTGGGCTACGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289312    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024779.4-413s21c1
Sequence:CCGGGCCCAGTCATTTCAAGTTCAACTCGAGTTGAACTTGAAATGACTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037719    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_024779.3-298s1c1
Sequence:CCGGGCCCAGTCATTTCAAGTTCAACTCGAGTTGAACTTGAAATGACTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037720    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024779.3-434s1c1
Sequence:CCGGCGCTTCCTTATCTCCTACGATCTCGAGATCGTAGGAGATAAGGAAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037722    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024779.3-1141s1c1
Sequence:CCGGCCTTACACAGTATGATGCCAACTCGAGTTGGCATCATACTGTGTAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037721    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024779.3-1115s1c1
Sequence:CCGGGTCTACTTCATGGGCCTCATTCTCGAGAATGAGGCCCATGAAGTAGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296193    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024779.4-1675s21c1
Sequence:CCGGGCCTTGATCTTTGTAATATCTCTCGAGAGATATTACAAAGATCAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194793    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_024779.3-350s1c1
Sequence:CCGGCGTGATCGATTTGGCATTGATCTCGAGATCAATGCCAAATCGATCACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196354    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_024779.3-1128s1c1
Sequence:CCGGGCCTCATTGATATCCTTACACCTCGAGGTGTAAGGATATCAATGAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196425    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_024779.3-1560s1c1
Sequence:CCGGGCCTTGATCTTTGTAATATCTCTCGAGAGATATTACAAAGATCAAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199085    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_024779.3-670s1c1
Sequence:CCGGCCTCAAGGGTTCCCTAGTGTCCTCGAGGACACTAGGGAACCCTTGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296192    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024779.4-785s21c1
Sequence:CCGGCCTCAAGGGTTCCCTAGTGTCCTCGAGGACACTAGGGAACCCTTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000310208    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024779.4-1243s21c1
Sequence:CCGGGCCTCATTGATATCCTTACACCTCGAGGTGTAAGGATATCAATGAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024779
VALIDATED
PIP4K2C MISSION shRNA shRNA Plasmid DNA
phosphatidylinositol-5-phosphate 4-kinase, type II, gamma
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000199809    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024779.3-177s1c1
Sequence:CCGGGCGTAGCCCACTCGATCAATGCTCGAGCATTGATCGAGTGGGCTACGCTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000289312    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024779.4-413s21c1
Sequence:CCGGGCCCAGTCATTTCAAGTTCAACTCGAGTTGAACTTGAAATGACTGGGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000037719    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_024779.3-298s1c1
Sequence:CCGGGCCCAGTCATTTCAAGTTCAACTCGAGTTGAACTTGAAATGACTGGGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000037720    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024779.3-434s1c1
Sequence:CCGGCGCTTCCTTATCTCCTACGATCTCGAGATCGTAGGAGATAAGGAAGCGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000037722    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024779.3-1141s1c1
Sequence:CCGGCCTTACACAGTATGATGCCAACTCGAGTTGGCATCATACTGTGTAAGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000037721    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024779.3-1115s1c1
Sequence:CCGGGTCTACTTCATGGGCCTCATTCTCGAGAATGAGGCCCATGAAGTAGACTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000296193    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024779.4-1675s21c1
Sequence:CCGGGCCTTGATCTTTGTAATATCTCTCGAGAGATATTACAAAGATCAAGGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000194793    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_024779.3-350s1c1
Sequence:CCGGCGTGATCGATTTGGCATTGATCTCGAGATCAATGCCAAATCGATCACGTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000196354    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_024779.3-1128s1c1
Sequence:CCGGGCCTCATTGATATCCTTACACCTCGAGGTGTAAGGATATCAATGAGGCTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000196425    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_024779.3-1560s1c1
Sequence:CCGGGCCTTGATCTTTGTAATATCTCTCGAGAGATATTACAAAGATCAAGGCTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000199085    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_024779.3-670s1c1
Sequence:CCGGCCTCAAGGGTTCCCTAGTGTCCTCGAGGACACTAGGGAACCCTTGAGGTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000296192    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024779.4-785s21c1
Sequence:CCGGCCTCAAGGGTTCCCTAGTGTCCTCGAGGACACTAGGGAACCCTTGAGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000310208    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024779.4-1243s21c1
Sequence:CCGGGCCTCATTGATATCCTTACACCTCGAGGTGTAAGGATATCAATGAGGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024779
VALIDATED
PIP4K2C MISSION shRNA Lentiviral Transduction Particles
phosphatidylinositol-5-phosphate 4-kinase, type II, gamma
Human
13 Products Total
TRC Number Volume Titer/mL Vector Price Set Price (5+)? Select
TRCN0000199809    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024779.3-177s1c1
Sequence:CCGGGCGTAGCCCACTCGATCAATGCTCGAGCATTGATCGAGTGGGCTACGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000289312    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024779.4-413s21c1
Sequence:CCGGGCCCAGTCATTTCAAGTTCAACTCGAGTTGAACTTGAAATGACTGGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037719    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_024779.3-298s1c1
Sequence:CCGGGCCCAGTCATTTCAAGTTCAACTCGAGTTGAACTTGAAATGACTGGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037720    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024779.3-434s1c1
Sequence:CCGGCGCTTCCTTATCTCCTACGATCTCGAGATCGTAGGAGATAAGGAAGCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037722    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024779.3-1141s1c1
Sequence:CCGGCCTTACACAGTATGATGCCAACTCGAGTTGGCATCATACTGTGTAAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037721    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024779.3-1115s1c1
Sequence:CCGGGTCTACTTCATGGGCCTCATTCTCGAGAATGAGGCCCATGAAGTAGACTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000296193    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024779.4-1675s21c1
Sequence:CCGGGCCTTGATCTTTGTAATATCTCTCGAGAGATATTACAAAGATCAAGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194793    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_024779.3-350s1c1
Sequence:CCGGCGTGATCGATTTGGCATTGATCTCGAGATCAATGCCAAATCGATCACGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196354    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_024779.3-1128s1c1
Sequence:CCGGGCCTCATTGATATCCTTACACCTCGAGGTGTAAGGATATCAATGAGGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196425    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_024779.3-1560s1c1
Sequence:CCGGGCCTTGATCTTTGTAATATCTCTCGAGAGATATTACAAAGATCAAGGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199085    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_024779.3-670s1c1
Sequence:CCGGCCTCAAGGGTTCCCTAGTGTCCTCGAGGACACTAGGGAACCCTTGAGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000296192    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024779.4-785s21c1
Sequence:CCGGCCTCAAGGGTTCCCTAGTGTCCTCGAGGACACTAGGGAACCCTTGAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000310208    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024779.4-1243s21c1
Sequence:CCGGGCCTCATTGATATCCTTACACCTCGAGGTGTAAGGATATCAATGAGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)