EMAIL THIS PAGE TO A FRIEND

PIP5K1A

phosphatidylinositol-4-phosphate 5-kinase, type I, alpha

121 Gene Product Result for
UniProtKB ID: Q99755, A8K4Q0, B4DIN0, Q99754, Q99756
Gene ID:
Mouse(18720) phosphatidylinositol-4-phosphate 5-kinase, type 1 alpha
Rat(365865) phosphatidylinositol-4-phosphate 5-kinase, type 1, alpha
chicken(429983) phosphatidylinositol-4-phosphate 5-kinase, type I, alpha
Horse(100059655) phosphatidylinositol-4-phosphate 5-kinase, type I, alpha
domestic cat(101098154) phosphatidylinositol-4-phosphate 5-kinase, type I, alpha
dog(475846) phosphatidylinositol-4-phosphate 5-kinase, type I, alpha
cow(100125224) phosphatidylinositol-4-phosphate 5-kinase, type I, alpha
sheep(101114069) phosphatidylinositol-4-phosphate 5-kinase, type I, alpha
domestic guinea pig(100715277) phosphatidylinositol-4-phosphate 5-kinase, type I, alpha
naked mole-rat(101703623) phosphatidylinositol-4-phosphate 5-kinase, type I, alpha
Domestic Rabbit(100328668) phosphatidylinositol-4-phosphate 5-kinase, type I, alpha
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008847 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008847 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008847 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003557 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003557 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003557 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003557 siRNAs that have been validated in the lab human pricing
NM_001042621 Rosetta Predictions rat pricing
NM_008847 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003557 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00097114 validated 2055
1 SASI_Hs01_00097115 validated 944
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001042621 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00204957 predicted 779
2 SASI_Rn02_00204958 predicted 1344
3 SASI_Rn02_00204959 predicted 437
4 SASI_Rn02_00204960 predicted 1168
5 SASI_Rn02_00204961 predicted 1005
6 SASI_Rn02_00204962 predicted 1672
7 SASI_Rn02_00204963 predicted 906
8 SASI_Rn02_00204964 predicted 903
9 SASI_Rn02_00204965 predicted 977
10 SASI_Rn02_00204966 predicted 748
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008847 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00138399 predicted 860
2 SASI_Mm01_00138400 predicted 2051
3 SASI_Mm01_00138401 predicted 1948
4 SASI_Mm01_00138402 predicted 1967
5 SASI_Mm02_00314788 predicted 2013
6 SASI_Mm01_00138403 predicted 918
7 SASI_Mm01_00138404 predicted 1274
8 SASI_Mm01_00138405 predicted 663
9 SASI_Mm01_00138406 predicted 2122
10 SASI_Mm01_00138407 predicted 1256
11 SASI_Mm01_00138408 predicted 1566
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008847
VALIDATED
PIP5K1A MISSION shRNA Bacterial Glycerol Stock
phosphatidylinositol-4-phosphate 5-kinase, type I, alpha
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000271202    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008847.2-1137s21c1
Sequence:CCGGGACCTGAAGGGTTCAACTTACCTCGAGGTAAGTTGAACCCTTCAGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271152    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008847.2-1227s21c1
Sequence:CCGGGATATCCCTGACGGCCTATTTCTCGAGAAATAGGCCGTCAGGGATATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271151    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008847.2-1019s21c1
Sequence:CCGGTCGTACTTTGCTGCCCAAATTCTCGAGAATTTGGGCAGCAAAGTACGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008847.2-867s1c1
Sequence:CCGGCCATTGATTGAACTCTCCAATCTCGAGATTGGAGAGTTCAATCAATGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024518    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008847.2-983s1c1
Sequence:CCGGGCTTCCAGGATACTACATGAACTCGAGTTCATGTAGTATCCTGGAAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024517    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008847.2-528s1c1
Sequence:CCGGGCCTCTGTCATGCCTGTTAAACTCGAGTTTAACAGGCATGACAGAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024515    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008847.2-758s1c1
Sequence:CCGGCCATTACAATGACTTTCGATTCTCGAGAATCGAAAGTCATTGTAATGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024514    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008847.2-1524s1c1
Sequence:CCGGGCCCGGAATAACAAAGGAGAACTCGAGTTCTCCTTTGTTATTCCGGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271203    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008847.2-1066s21c1
Sequence:CCGGGCGGCAAGAACATACGAATTGCTCGAGCAATTCGTATGTTCTTGCCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008847
VALIDATED
PIP5K1A MISSION shRNA shRNA Plasmid DNA
phosphatidylinositol-4-phosphate 5-kinase, type I, alpha
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000271202    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008847.2-1137s21c1
Sequence:CCGGGACCTGAAGGGTTCAACTTACCTCGAGGTAAGTTGAACCCTTCAGGTCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000271152    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008847.2-1227s21c1
Sequence:CCGGGATATCCCTGACGGCCTATTTCTCGAGAAATAGGCCGTCAGGGATATCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000271151    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008847.2-1019s21c1
Sequence:CCGGTCGTACTTTGCTGCCCAAATTCTCGAGAATTTGGGCAGCAAAGTACGATTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000024516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008847.2-867s1c1
Sequence:CCGGCCATTGATTGAACTCTCCAATCTCGAGATTGGAGAGTTCAATCAATGGTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000024518    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008847.2-983s1c1
Sequence:CCGGGCTTCCAGGATACTACATGAACTCGAGTTCATGTAGTATCCTGGAAGCTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000024517    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008847.2-528s1c1
Sequence:CCGGGCCTCTGTCATGCCTGTTAAACTCGAGTTTAACAGGCATGACAGAGGCTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000024515    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008847.2-758s1c1
Sequence:CCGGCCATTACAATGACTTTCGATTCTCGAGAATCGAAAGTCATTGTAATGGTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000024514    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008847.2-1524s1c1
Sequence:CCGGGCCCGGAATAACAAAGGAGAACTCGAGTTCTCCTTTGTTATTCCGGGCTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000271203    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008847.2-1066s21c1
Sequence:CCGGGCGGCAAGAACATACGAATTGCTCGAGCAATTCGTATGTTCTTGCCGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008847
VALIDATED
PIP5K1A MISSION shRNA Lentiviral Transduction Particles
phosphatidylinositol-4-phosphate 5-kinase, type I, alpha
Mouse
9 Products Total
TRC Number Volume Titer/mL Vector Price Set Price (5+)? Select
TRCN0000271202    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008847.2-1137s21c1
Sequence:CCGGGACCTGAAGGGTTCAACTTACCTCGAGGTAAGTTGAACCCTTCAGGTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000271152    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008847.2-1227s21c1
Sequence:CCGGGATATCCCTGACGGCCTATTTCTCGAGAAATAGGCCGTCAGGGATATCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000271151    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008847.2-1019s21c1
Sequence:CCGGTCGTACTTTGCTGCCCAAATTCTCGAGAATTTGGGCAGCAAAGTACGATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008847.2-867s1c1
Sequence:CCGGCCATTGATTGAACTCTCCAATCTCGAGATTGGAGAGTTCAATCAATGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024518    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008847.2-983s1c1
Sequence:CCGGGCTTCCAGGATACTACATGAACTCGAGTTCATGTAGTATCCTGGAAGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024517    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008847.2-528s1c1
Sequence:CCGGGCCTCTGTCATGCCTGTTAAACTCGAGTTTAACAGGCATGACAGAGGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024515    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008847.2-758s1c1
Sequence:CCGGCCATTACAATGACTTTCGATTCTCGAGAATCGAAAGTCATTGTAATGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024514    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008847.2-1524s1c1
Sequence:CCGGGCCCGGAATAACAAAGGAGAACTCGAGTTCTCCTTTGTTATTCCGGGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000271203    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008847.2-1066s21c1
Sequence:CCGGGCGGCAAGAACATACGAATTGCTCGAGCAATTCGTATGTTCTTGCCGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003557
VALIDATED
PIP5K1A MISSION shRNA Bacterial Glycerol Stock
phosphatidylinositol-4-phosphate 5-kinase, type I, alpha
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000231477    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_003557.1-938s21c1
Sequence:CCGGATTAAGACAGTCCAACATAAACTCGAGTTTATGTTGGACTGTCTTAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231480    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_003557.1-2031s21c1
Sequence:CCGGAGTCAGAGTTCACCCATTAAGCTCGAGCTTAATGGGTGAACTCTGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231478    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003557.1-1018s21c1
Sequence:CCGGTCGGACTTTGCTGCCTAAATTCTCGAGAATTTAGGCAGCAAAGTCCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195028    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003557.1-1333s1c1
Sequence:CCGGCCTCTTGATGTCAATCCATAACTCGAGTTATGGATTGACATCAAGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199304    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003557.1-2408s1c1
Sequence:CCGGCCCTCGTCTTTGACTAGGAACCTCGAGGTTCCTAGTCAAAGACGAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196711    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003557.1-680s1c1
Sequence:CCGGGATGTCCTCATGCAAGATTTCCTCGAGGAAATCTTGCATGAGGACATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195099    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003557.1-922s1c1
Sequence:CCGGCGACGATGAGTTCATTATTAACTCGAGTTAATAATGAACTCATCGTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231479    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003557.1-1334s21c1
Sequence:CCGGCTCTTGATGTCAATCCATAATCTCGAGATTATGGATTGACATCAAGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010138    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003557.x-1897s1c1
Sequence:CCGGTTTACCTCAGACTCCACCTTTCTCGAGAAAGGTGGAGTCTGAGGTAAATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010142    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003557.x-551s1c1
Sequence:CCGGATAGGCCATAGAAGTGTTGATCTCGAGATCAACACTTCTATGGCCTATTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010143    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003557.x-626s1c1
Sequence:CCGGATCCAGTTAGGCATTACCCACCTCGAGGTGGGTAATGCCTAACTGGATTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010128    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003557.x-1403s1c1
Sequence:CCGGGTTGATACTCGAAGACCGGCCCTCGAGGGCCGGTCTTCGAGTATCAACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010129    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003557.x-1621s1c1
Sequence:CCGGAGCCCTGGTACATGACGGAGACTCGAGTCTCCGTCATGTACCAGGGCTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231481    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_003557.1-2450s21c1
Sequence:CCGGACAGACTAGCTGGCACATTATCTCGAGATAATGTGCCAGCTAGTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003557
VALIDATED
PIP5K1A MISSION shRNA shRNA Plasmid DNA
phosphatidylinositol-4-phosphate 5-kinase, type I, alpha
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000231477    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_003557.1-938s21c1
Sequence:CCGGATTAAGACAGTCCAACATAAACTCGAGTTTATGTTGGACTGTCTTAATTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000231480    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_003557.1-2031s21c1
Sequence:CCGGAGTCAGAGTTCACCCATTAAGCTCGAGCTTAATGGGTGAACTCTGACTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000231478    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003557.1-1018s21c1
Sequence:CCGGTCGGACTTTGCTGCCTAAATTCTCGAGAATTTAGGCAGCAAAGTCCGATTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000195028    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003557.1-1333s1c1
Sequence:CCGGCCTCTTGATGTCAATCCATAACTCGAGTTATGGATTGACATCAAGAGGTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000199304    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003557.1-2408s1c1
Sequence:CCGGCCCTCGTCTTTGACTAGGAACCTCGAGGTTCCTAGTCAAAGACGAGGGTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000196711    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003557.1-680s1c1
Sequence:CCGGGATGTCCTCATGCAAGATTTCCTCGAGGAAATCTTGCATGAGGACATCTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000195099    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003557.1-922s1c1
Sequence:CCGGCGACGATGAGTTCATTATTAACTCGAGTTAATAATGAACTCATCGTCGTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000231479    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003557.1-1334s21c1
Sequence:CCGGCTCTTGATGTCAATCCATAATCTCGAGATTATGGATTGACATCAAGAGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000010138    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003557.x-1897s1c1
Sequence:CCGGTTTACCTCAGACTCCACCTTTCTCGAGAAAGGTGGAGTCTGAGGTAAATTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000010142    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003557.x-551s1c1
Sequence:CCGGATAGGCCATAGAAGTGTTGATCTCGAGATCAACACTTCTATGGCCTATTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000010143    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003557.x-626s1c1
Sequence:CCGGATCCAGTTAGGCATTACCCACCTCGAGGTGGGTAATGCCTAACTGGATTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000010128    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003557.x-1403s1c1
Sequence:CCGGGTTGATACTCGAAGACCGGCCCTCGAGGGCCGGTCTTCGAGTATCAACTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000010129    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003557.x-1621s1c1
Sequence:CCGGAGCCCTGGTACATGACGGAGACTCGAGTCTCCGTCATGTACCAGGGCTTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000231481    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_003557.1-2450s21c1
Sequence:CCGGACAGACTAGCTGGCACATTATCTCGAGATAATGTGCCAGCTAGTCTGTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003557
VALIDATED
PIP5K1A MISSION shRNA Lentiviral Transduction Particles
phosphatidylinositol-4-phosphate 5-kinase, type I, alpha
Human
14 Products Total
TRC Number Volume Titer/mL Vector Price Set Price (5+)? Select
TRCN0000231477    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_003557.1-938s21c1
Sequence:CCGGATTAAGACAGTCCAACATAAACTCGAGTTTATGTTGGACTGTCTTAATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231480    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_003557.1-2031s21c1
Sequence:CCGGAGTCAGAGTTCACCCATTAAGCTCGAGCTTAATGGGTGAACTCTGACTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231478    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003557.1-1018s21c1
Sequence:CCGGTCGGACTTTGCTGCCTAAATTCTCGAGAATTTAGGCAGCAAAGTCCGATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195028    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003557.1-1333s1c1
Sequence:CCGGCCTCTTGATGTCAATCCATAACTCGAGTTATGGATTGACATCAAGAGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199304    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003557.1-2408s1c1
Sequence:CCGGCCCTCGTCTTTGACTAGGAACCTCGAGGTTCCTAGTCAAAGACGAGGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196711    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003557.1-680s1c1
Sequence:CCGGGATGTCCTCATGCAAGATTTCCTCGAGGAAATCTTGCATGAGGACATCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195099    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003557.1-922s1c1
Sequence:CCGGCGACGATGAGTTCATTATTAACTCGAGTTAATAATGAACTCATCGTCGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231479    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003557.1-1334s21c1
Sequence:CCGGCTCTTGATGTCAATCCATAATCTCGAGATTATGGATTGACATCAAGAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010138    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003557.x-1897s1c1
Sequence:CCGGTTTACCTCAGACTCCACCTTTCTCGAGAAAGGTGGAGTCTGAGGTAAATTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010142    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003557.x-551s1c1
Sequence:CCGGATAGGCCATAGAAGTGTTGATCTCGAGATCAACACTTCTATGGCCTATTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010143    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003557.x-626s1c1
Sequence:CCGGATCCAGTTAGGCATTACCCACCTCGAGGTGGGTAATGCCTAACTGGATTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010128    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003557.x-1403s1c1
Sequence:CCGGGTTGATACTCGAAGACCGGCCCTCGAGGGCCGGTCTTCGAGTATCAACTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010129    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003557.x-1621s1c1
Sequence:CCGGAGCCCTGGTACATGACGGAGACTCGAGTCTCCGTCATGTACCAGGGCTTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231481    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_003557.1-2450s21c1
Sequence:CCGGACAGACTAGCTGGCACATTATCTCGAGATAATGTGCCAGCTAGTCTGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)