EMAIL THIS PAGE TO A FRIEND

PIP5K1B

phosphatidylinositol-4-phosphate 5-kinase, type I, beta

229 Gene Product Result for
Synonyms: MSS4 STM7
Gene ID:
Mouse(18719) phosphatidylinositol-4-phosphate 5-kinase, type 1 beta
Rat(309419) phosphatidylinositol-4-phosphate 5-kinase, type I, beta
chicken(427243) phosphatidylinositol-4-phosphate 5-kinase, type I, beta
dog(476331) phosphatidylinositol-4-phosphate 5-kinase, type I, beta
Horse(100050520) phosphatidylinositol-4-phosphate 5-kinase, type I, beta
domestic cat(101081420) phosphatidylinositol-4-phosphate 5-kinase, type I, beta
Domestic Rabbit(100356255) phosphatidylinositol-4-phosphate 5-kinase, type I, beta
naked mole-rat(101726083) phosphatidylinositol-4-phosphate 5-kinase, type I, beta
domestic guinea pig(100728992) phosphatidylinositol-4-phosphate 5-kinase, type I, beta
cow(537654) phosphatidylinositol-4-phosphate 5-kinase, type I, beta
sheep(101107667) phosphatidylinositol-4-phosphate 5-kinase, type I, beta
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003558 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003558 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003558 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008846 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008846 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008846 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001031687 Rosetta Predictions human pricing
NM_003558 Rosetta Predictions human pricing
NM_001012743 Rosetta Predictions rat pricing
NM_008846 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001031687 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00147282 predicted 1094
2 SASI_Hs01_00147283 predicted 1039
3 SASI_Hs01_00147284 predicted 765
4 SASI_Hs01_00147285 predicted 1101
5 SASI_Hs01_00147286 predicted 1668
6 SASI_Hs01_00147287 predicted 969
7 SASI_Hs01_00147288 predicted 724
8 SASI_Hs01_00147289 predicted 1011
9 SASI_Hs01_00147290 predicted 1154
10 SASI_Hs01_00147291 predicted 1217
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003558 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00335838 predicted 1935
2 SASI_Hs02_00335839 predicted 1243
3 SASI_Hs01_00027647 predicted 905
4 SASI_Hs01_00027648 predicted 632
5 SASI_Hs02_00335840 predicted 1787
6 SASI_Hs01_00027650 predicted 1549
7 SASI_Hs02_00335841 predicted 556
8 SASI_Hs01_00027652 predicted 595
9 SASI_Hs02_00335842 predicted 1953
10 SASI_Hs02_00335843 predicted 1228
11 SASI_Hs01_00027646 predicted 1085
12 SASI_Hs01_00027649 predicted 1100
13 SASI_Hs01_00027651 predicted 963
14 SASI_Hs01_00027653 predicted 1013
15 SASI_Hs01_00027654 predicted 1147
16 SASI_Hs01_00027655 predicted 1209
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012743 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00045250 predicted 1968
2 SASI_Rn01_00045251 predicted 2124
3 SASI_Rn01_00045252 predicted 1957
4 SASI_Rn01_00045253 predicted 1618
5 SASI_Rn01_00045254 predicted 815
6 SASI_Rn01_00045256 predicted 1261
7 SASI_Rn02_00200602 predicted 1564
8 SASI_Rn01_00045257 predicted 793
9 SASI_Rn01_00045258 predicted 2043
10 SASI_Rn01_00045259 predicted 1193
11 SASI_Rn01_00045255 predicted 1554
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008846 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00171452 predicted 1689
2 SASI_Mm01_00171453 predicted 437
3 SASI_Mm01_00171454 predicted 1172
4 SASI_Mm01_00171455 predicted 418
5 SASI_Mm01_00171456 predicted 604
6 SASI_Mm01_00171457 predicted 884
7 SASI_Mm01_00171458 predicted 1663
8 SASI_Mm01_00171459 predicted 1241
9 SASI_Mm01_00171461 predicted 1198
10 SASI_Mm02_00314787 predicted 1367
11 SASI_Mm01_00171460 predicted 619
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003558
VALIDATED
PIP5K1B MISSION shRNA Bacterial Glycerol Stock
phosphatidylinositol-4-phosphate 5-kinase, type I, beta
Human
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000230742    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003558.2-567s21c1
Sequence:CCGGCCATTAGCATTCCGATATTTCCTCGAGGAAATATCGGAATGCTAATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230745    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003558.2-1905s21c1
Sequence:CCGGTCTGTGCTTGACGTCTATTTACTCGAGTAAATAGACGTCAAGCACAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359135    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003558.2-2116s21c1
Sequence:CCGGTACTACCCTATTCTATCATTTCTCGAGAAATGATAGAATAGGGTAGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037860    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003558.1-1636s1c1
Sequence:CCGGCGTCTAAGAAACGGTGCAATTCTCGAGAATTGCACCGTTTCTTAGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359201    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_003558.2-1003s21c1
Sequence:CCGGACATGCACGAAGGGTTGTATTCTCGAGAATACAACCCTTCGTGCATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230743    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003558.2-831s21c1
Sequence:CCGGATGCAATCAGGAGGCATTAATCTCGAGATTAATGCCTCCTGATTGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037861    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003558.1-677s1c1
Sequence:CCGGCGCTCCATTAGCATTCCGATACTCGAGTATCGGAATGCTAATGGAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037862    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003558.1-1144s1c1
Sequence:CCGGCGGAAACATACAACGCGCTTACTCGAGTAAGCGCGTTGTATGTTTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037863    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003558.1-642s1c1
Sequence:CCGGGCACATCACTACCCAGACTTTCTCGAGAAAGTCTGGGTAGTGATGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037859    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003558.1-876s1c1
Sequence:CCGGCCAGGCTATTACATGAATTTACTCGAGTAAATTCATGTAATAGCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197135    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003558.1-1736s1c1
Sequence:CCGGGCTGACTGAAGGACAAAGTTTCTCGAGAAACTTTGTCCTTCAGTCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196843    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003558.1-2398s1c1
Sequence:CCGGGCAACATATGTAATCTGCTTACTCGAGTAAGCAGATTACATATGTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218779    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003558.2-2325s21c1
Sequence:GTACCGGCATCCACACACATGGTAAATTCTCGAGAATTTACCATGTGTGTGGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230744    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_003558.2-1780s21c1
Sequence:CCGGACGACAGGCCTACACTCTATTCTCGAGAATAGAGTGTAGGCCTGTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359136    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_003558.2-629s21c1
Sequence:CCGGCATCTGCAGTGAACCTCTAATCTCGAGATTAGAGGTTCACTGCAGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003558
VALIDATED
PIP5K1B MISSION shRNA shRNA Plasmid DNA
phosphatidylinositol-4-phosphate 5-kinase, type I, beta
Human
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000230742    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003558.2-567s21c1
Sequence:CCGGCCATTAGCATTCCGATATTTCCTCGAGGAAATATCGGAATGCTAATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230745    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003558.2-1905s21c1
Sequence:CCGGTCTGTGCTTGACGTCTATTTACTCGAGTAAATAGACGTCAAGCACAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000359135    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003558.2-2116s21c1
Sequence:CCGGTACTACCCTATTCTATCATTTCTCGAGAAATGATAGAATAGGGTAGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037860    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003558.1-1636s1c1
Sequence:CCGGCGTCTAAGAAACGGTGCAATTCTCGAGAATTGCACCGTTTCTTAGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000359201    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_003558.2-1003s21c1
Sequence:CCGGACATGCACGAAGGGTTGTATTCTCGAGAATACAACCCTTCGTGCATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230743    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003558.2-831s21c1
Sequence:CCGGATGCAATCAGGAGGCATTAATCTCGAGATTAATGCCTCCTGATTGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037861    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003558.1-677s1c1
Sequence:CCGGCGCTCCATTAGCATTCCGATACTCGAGTATCGGAATGCTAATGGAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037862    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003558.1-1144s1c1
Sequence:CCGGCGGAAACATACAACGCGCTTACTCGAGTAAGCGCGTTGTATGTTTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037863    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003558.1-642s1c1
Sequence:CCGGGCACATCACTACCCAGACTTTCTCGAGAAAGTCTGGGTAGTGATGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037859    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003558.1-876s1c1
Sequence:CCGGCCAGGCTATTACATGAATTTACTCGAGTAAATTCATGTAATAGCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000197135    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003558.1-1736s1c1
Sequence:CCGGGCTGACTGAAGGACAAAGTTTCTCGAGAAACTTTGTCCTTCAGTCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196843    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003558.1-2398s1c1
Sequence:CCGGGCAACATATGTAATCTGCTTACTCGAGTAAGCAGATTACATATGTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000218779    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003558.2-2325s21c1
Sequence:GTACCGGCATCCACACACATGGTAAATTCTCGAGAATTTACCATGTGTGTGGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230744    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_003558.2-1780s21c1
Sequence:CCGGACGACAGGCCTACACTCTATTCTCGAGAATAGAGTGTAGGCCTGTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000359136    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_003558.2-629s21c1
Sequence:CCGGCATCTGCAGTGAACCTCTAATCTCGAGATTAGAGGTTCACTGCAGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003558
VALIDATED
PIP5K1B MISSION shRNA Lentiviral Transduction Particles
phosphatidylinositol-4-phosphate 5-kinase, type I, beta
Human
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000230742    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003558.2-567s21c1
Sequence:CCGGCCATTAGCATTCCGATATTTCCTCGAGGAAATATCGGAATGCTAATGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230745    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003558.2-1905s21c1
Sequence:CCGGTCTGTGCTTGACGTCTATTTACTCGAGTAAATAGACGTCAAGCACAGATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000359135    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003558.2-2116s21c1
Sequence:CCGGTACTACCCTATTCTATCATTTCTCGAGAAATGATAGAATAGGGTAGTATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037860    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003558.1-1636s1c1
Sequence:CCGGCGTCTAAGAAACGGTGCAATTCTCGAGAATTGCACCGTTTCTTAGACGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000359201    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_003558.2-1003s21c1
Sequence:CCGGACATGCACGAAGGGTTGTATTCTCGAGAATACAACCCTTCGTGCATGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230743    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003558.2-831s21c1
Sequence:CCGGATGCAATCAGGAGGCATTAATCTCGAGATTAATGCCTCCTGATTGCATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037861    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003558.1-677s1c1
Sequence:CCGGCGCTCCATTAGCATTCCGATACTCGAGTATCGGAATGCTAATGGAGCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037862    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003558.1-1144s1c1
Sequence:CCGGCGGAAACATACAACGCGCTTACTCGAGTAAGCGCGTTGTATGTTTCCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037863    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003558.1-642s1c1
Sequence:CCGGGCACATCACTACCCAGACTTTCTCGAGAAAGTCTGGGTAGTGATGTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037859    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003558.1-876s1c1
Sequence:CCGGCCAGGCTATTACATGAATTTACTCGAGTAAATTCATGTAATAGCCTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000197135    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003558.1-1736s1c1
Sequence:CCGGGCTGACTGAAGGACAAAGTTTCTCGAGAAACTTTGTCCTTCAGTCAGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196843    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003558.1-2398s1c1
Sequence:CCGGGCAACATATGTAATCTGCTTACTCGAGTAAGCAGATTACATATGTTGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000218779    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003558.2-2325s21c1
Sequence:GTACCGGCATCCACACACATGGTAAATTCTCGAGAATTTACCATGTGTGTGGATGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230744    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_003558.2-1780s21c1
Sequence:CCGGACGACAGGCCTACACTCTATTCTCGAGAATAGAGTGTAGGCCTGTCGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000359136    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_003558.2-629s21c1
Sequence:CCGGCATCTGCAGTGAACCTCTAATCTCGAGATTAGAGGTTCACTGCAGATGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008846
PIP5K1B MISSION shRNA Bacterial Glycerol Stock
phosphatidylinositol-4-phosphate 5-kinase, type I, beta
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000024584    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008846.1-1137s1c1
Sequence:CCGGCCTCCAATCATATAGGTTAATCTCGAGATTAACCTATATGATTGGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024586    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008846.1-366s1c1
Sequence:CCGGCCGAGAACTCTTTGGTATCAACTCGAGTTGATACCAAAGAGTTCTCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024587    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008846.1-161s1c1
Sequence:CCGGCGTCAGCTATTAAAGGTGCTACTCGAGTAGCACCTTTAATAGCTGACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024588    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008846.1-1205s1c1
Sequence:CCGGCCGTTTCAGTTCATAGACCAACTCGAGTTGGTCTATGAACTGAAACGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024585    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008846.1-542s1c1
Sequence:CCGGCGGGCTATTACATGAATTTAACTCGAGTTAAATTCATGTAATAGCCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361427    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008846.2-220s21c1
Sequence:CCGGGACGGCATCGTCAGCTATTAACTCGAGTTAATAGCTGACGATGCCGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361359    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008846.2-2061s21c1
Sequence:CCGGTTGGACTGGGAAGCGCTATTTCTCGAGAAATAGCGCTTCCCAGTCCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008846
PIP5K1B MISSION shRNA shRNA Plasmid DNA
phosphatidylinositol-4-phosphate 5-kinase, type I, beta
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000024584    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008846.1-1137s1c1
Sequence:CCGGCCTCCAATCATATAGGTTAATCTCGAGATTAACCTATATGATTGGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024586    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008846.1-366s1c1
Sequence:CCGGCCGAGAACTCTTTGGTATCAACTCGAGTTGATACCAAAGAGTTCTCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024587    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008846.1-161s1c1
Sequence:CCGGCGTCAGCTATTAAAGGTGCTACTCGAGTAGCACCTTTAATAGCTGACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024588    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008846.1-1205s1c1
Sequence:CCGGCCGTTTCAGTTCATAGACCAACTCGAGTTGGTCTATGAACTGAAACGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024585    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008846.1-542s1c1
Sequence:CCGGCGGGCTATTACATGAATTTAACTCGAGTTAAATTCATGTAATAGCCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000361427    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008846.2-220s21c1
Sequence:CCGGGACGGCATCGTCAGCTATTAACTCGAGTTAATAGCTGACGATGCCGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000361359    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008846.2-2061s21c1
Sequence:CCGGTTGGACTGGGAAGCGCTATTTCTCGAGAAATAGCGCTTCCCAGTCCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008846
PIP5K1B MISSION shRNA Lentiviral Transduction Particles
phosphatidylinositol-4-phosphate 5-kinase, type I, beta
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000024584    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008846.1-1137s1c1
Sequence:CCGGCCTCCAATCATATAGGTTAATCTCGAGATTAACCTATATGATTGGAGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024586    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008846.1-366s1c1
Sequence:CCGGCCGAGAACTCTTTGGTATCAACTCGAGTTGATACCAAAGAGTTCTCGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024587    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008846.1-161s1c1
Sequence:CCGGCGTCAGCTATTAAAGGTGCTACTCGAGTAGCACCTTTAATAGCTGACGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024588    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008846.1-1205s1c1
Sequence:CCGGCCGTTTCAGTTCATAGACCAACTCGAGTTGGTCTATGAACTGAAACGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024585    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008846.1-542s1c1
Sequence:CCGGCGGGCTATTACATGAATTTAACTCGAGTTAAATTCATGTAATAGCCCGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000361427    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008846.2-220s21c1
Sequence:CCGGGACGGCATCGTCAGCTATTAACTCGAGTTAATAGCTGACGATGCCGTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000361359    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008846.2-2061s21c1
Sequence:CCGGTTGGACTGGGAAGCGCTATTTCTCGAGAAATAGCGCTTCCCAGTCCAATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)