EMAIL THIS PAGE TO A FRIEND

PIP5K1C

phosphatidylinositol-4-phosphate 5-kinase, type I, gamma

79 Gene Product Result for
Synonyms: LCCS3 PIP5K-GAMMA PIP5Kgamma PIPKIg_v4
UniProtKB ID: O60331, B7Z9E7, C6GIJ7, C6GIJ8, Q7LE07
Gene ID:
Human(23396) Summary: This locus encodes a type I phosphatidylinositol 4-phosphate 5-kinase. The encoded protein catalyzes phosphorylation of phosphatidylinositol 4-phosphate, producing phosphatidylinositol 4,5-bisphosphate. This enzyme is found at synapses and has been found to play roles in endocytosis and cell migration. Mutations at this locus have been associated with lethal congenital contractural syndrome. Alternatively spliced transcript variants encoding different isoforms have been described.[provided by RefSeq, Sep 2010]
Mouse(18717) phosphatidylinositol-4-phosphate 5-kinase, type 1 gamma
Rat(314641) phosphatidylinositol-4-phosphate 5-kinase, type I, gamma
chicken(420072) phosphatidylinositol-4-phosphate 5-kinase, type I, gamma
dog(485054) phosphatidylinositol-4-phosphate 5-kinase, type I, gamma
domestic cat(101097791) phosphatidylinositol-4-phosphate 5-kinase, type I, gamma
cow(508819) phosphatidylinositol-4-phosphate 5-kinase, type I, gamma
sheep(101115537) phosphatidylinositol-4-phosphate 5-kinase, type I, gamma
domestic guinea pig(100717867) phosphatidylinositol-4-phosphate 5-kinase, type I, gamma
naked mole-rat(101700633) phosphatidylinositol-4-phosphate 5-kinase, type I, gamma
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_012398 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012398 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012398 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008844 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008844 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008844 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU047771 MISSION® esiRNA esiRNA targeting mouse Pip5k1c (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012398 Rosetta Predictions human pricing
NM_001009967 Rosetta Predictions rat pricing
NM_001033970 Rosetta Predictions rat pricing
NM_008844 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012398 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00126594 predicted 1338
2 SASI_Hs02_00344213 predicted 933
3 SASI_Hs01_00126595 predicted 810
4 SASI_Hs01_00126596 predicted 2332
5 SASI_Hs01_00126597 predicted 539
6 SASI_Hs01_00126598 predicted 2293
7 SASI_Hs01_00126599 predicted 868
8 SASI_Hs01_00126600 predicted 1758
9 SASI_Hs01_00126601 predicted 789
10 SASI_Hs01_00126602 predicted 440
11 SASI_Hs01_00126603 predicted 1256
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001009967 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00199802 predicted 1289
2 SASI_Rn01_00096704 predicted 432
3 SASI_Rn02_00199803 predicted 694
4 SASI_Rn01_00096705 predicted 336
5 SASI_Rn01_00096706 predicted 817
6 SASI_Rn01_00096707 predicted 341
7 SASI_Rn01_00096708 predicted 1693
8 SASI_Rn01_00096709 predicted 1499
9 SASI_Rn02_00199804 predicted 1252
10 SASI_Rn02_00199805 predicted 1404
11 SASI_Rn01_00096703 predicted 638
12 SASI_Rn01_00096710 predicted 1182
13 SASI_Rn01_00096711 predicted 861
14 SASI_Rn01_00096712 predicted 409
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033970 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00203847 predicted 1292
2 SASI_Rn02_00203848 predicted 438
3 SASI_Rn02_00203849 predicted 698
4 SASI_Rn02_00203850 predicted 335
5 SASI_Rn02_00203851 predicted 814
6 SASI_Rn02_00203852 predicted 344
7 SASI_Rn02_00203853 predicted 1699
8 SASI_Rn02_00203854 predicted 1505
9 SASI_Rn02_00203855 predicted 1260
10 SASI_Rn02_00203856 predicted 1403
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008844 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00069702 predicted 1525
2 SASI_Mm01_00069703 predicted 1307
3 SASI_Mm02_00314784 predicted 1950
4 SASI_Mm01_00069704 predicted 1262
5 SASI_Mm01_00069705 predicted 838
6 SASI_Mm01_00069706 predicted 685
7 SASI_Mm01_00069707 predicted 1962
8 SASI_Mm01_00069708 predicted 1252
9 SASI_Mm01_00069709 predicted 1716
10 SASI_Mm01_00069710 predicted 525
11 SASI_Mm01_00069711 predicted 1285
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012398
VALIDATED
PIP5K1C MISSION shRNA Bacterial Glycerol Stock
phosphatidylinositol-4-phosphate 5-kinase, type I, gamma
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000378595    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_012398.1-2046s21c1
Sequence:CCGGCGGCGAGAGCGACACATAATTCTCGAGAATTATGTGTCGCTCTCGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000363153    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012398.1-2302s21c1
Sequence:CCGGATCGCATTTGAGTCCTTATTTCTCGAGAAATAAGGACTCAAATGCGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194679    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012398.1-2300s1c1
Sequence:CCGGCAATCGCATTTGAGTCCTTATCTCGAGATAAGGACTCAAATGCGATTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195424    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012398.1-1601s1c1
Sequence:CCGGCTTTCGAAGAAGCCACTACAGCTCGAGCTGTAGTGGCTTCTTCGAAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199143    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012398.1-175s1c1
Sequence:CCGGCCAACAGAGGTTCTGTCCATGCTCGAGCATGGACAGAACCTCTGTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199413    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012398.1-1592s1c1
Sequence:CCGGCGCCACCTTCTTTCGAAGAAGCTCGAGCTTCTTCGAAAGAAGGTGGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037665    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012398.1-255s1c1
Sequence:CCGGCGGCGAAACCACCTACAAGAACTCGAGTTCTTGTAGGTGGTTTCGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037664    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012398.1-1257s1c1
Sequence:CCGGGCAGTCCTACAGGTTCATCAACTCGAGTTGATGAACCTGTAGGACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037667    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012398.1-1983s1c1
Sequence:CCGGCGATGAGAGGAGCTGGGTGTACTCGAGTACACCCAGCTCCTCTCATCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037668    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_012398.1-1377s1c1
Sequence:CCGGCAACACGGTCTTTCGGAAGAACTCGAGTTCTTCCGAAAGACCGTGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037666    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012398.1-789s1c1
Sequence:CCGGCGTGGTCAAGATGCACCTCAACTCGAGTTGAGGTGCATCTTGACCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000363133    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012398.1-1370s21c1
Sequence:CCGGTCATGAGCAACACGGTCTTTCCTCGAGGAAAGACCGTGTTGCTCATGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012398
VALIDATED
PIP5K1C MISSION shRNA shRNA Plasmid DNA
phosphatidylinositol-4-phosphate 5-kinase, type I, gamma
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000378595    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_012398.1-2046s21c1
Sequence:CCGGCGGCGAGAGCGACACATAATTCTCGAGAATTATGTGTCGCTCTCGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000363153    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012398.1-2302s21c1
Sequence:CCGGATCGCATTTGAGTCCTTATTTCTCGAGAAATAAGGACTCAAATGCGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194679    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012398.1-2300s1c1
Sequence:CCGGCAATCGCATTTGAGTCCTTATCTCGAGATAAGGACTCAAATGCGATTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195424    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012398.1-1601s1c1
Sequence:CCGGCTTTCGAAGAAGCCACTACAGCTCGAGCTGTAGTGGCTTCTTCGAAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199143    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012398.1-175s1c1
Sequence:CCGGCCAACAGAGGTTCTGTCCATGCTCGAGCATGGACAGAACCTCTGTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199413    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012398.1-1592s1c1
Sequence:CCGGCGCCACCTTCTTTCGAAGAAGCTCGAGCTTCTTCGAAAGAAGGTGGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037665    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012398.1-255s1c1
Sequence:CCGGCGGCGAAACCACCTACAAGAACTCGAGTTCTTGTAGGTGGTTTCGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037664    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012398.1-1257s1c1
Sequence:CCGGGCAGTCCTACAGGTTCATCAACTCGAGTTGATGAACCTGTAGGACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037667    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012398.1-1983s1c1
Sequence:CCGGCGATGAGAGGAGCTGGGTGTACTCGAGTACACCCAGCTCCTCTCATCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037668    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_012398.1-1377s1c1
Sequence:CCGGCAACACGGTCTTTCGGAAGAACTCGAGTTCTTCCGAAAGACCGTGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037666    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012398.1-789s1c1
Sequence:CCGGCGTGGTCAAGATGCACCTCAACTCGAGTTGAGGTGCATCTTGACCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000363133    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012398.1-1370s21c1
Sequence:CCGGTCATGAGCAACACGGTCTTTCCTCGAGGAAAGACCGTGTTGCTCATGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012398
VALIDATED
PIP5K1C MISSION shRNA Lentiviral Transduction Particles
phosphatidylinositol-4-phosphate 5-kinase, type I, gamma
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000378595    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_012398.1-2046s21c1
Sequence:CCGGCGGCGAGAGCGACACATAATTCTCGAGAATTATGTGTCGCTCTCGCCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000363153    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012398.1-2302s21c1
Sequence:CCGGATCGCATTTGAGTCCTTATTTCTCGAGAAATAAGGACTCAAATGCGATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194679    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012398.1-2300s1c1
Sequence:CCGGCAATCGCATTTGAGTCCTTATCTCGAGATAAGGACTCAAATGCGATTGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195424    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012398.1-1601s1c1
Sequence:CCGGCTTTCGAAGAAGCCACTACAGCTCGAGCTGTAGTGGCTTCTTCGAAAGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199143    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012398.1-175s1c1
Sequence:CCGGCCAACAGAGGTTCTGTCCATGCTCGAGCATGGACAGAACCTCTGTTGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199413    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012398.1-1592s1c1
Sequence:CCGGCGCCACCTTCTTTCGAAGAAGCTCGAGCTTCTTCGAAAGAAGGTGGCGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037665    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012398.1-255s1c1
Sequence:CCGGCGGCGAAACCACCTACAAGAACTCGAGTTCTTGTAGGTGGTTTCGCCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037664    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012398.1-1257s1c1
Sequence:CCGGGCAGTCCTACAGGTTCATCAACTCGAGTTGATGAACCTGTAGGACTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037667    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012398.1-1983s1c1
Sequence:CCGGCGATGAGAGGAGCTGGGTGTACTCGAGTACACCCAGCTCCTCTCATCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037668    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_012398.1-1377s1c1
Sequence:CCGGCAACACGGTCTTTCGGAAGAACTCGAGTTCTTCCGAAAGACCGTGTTGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037666    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012398.1-789s1c1
Sequence:CCGGCGTGGTCAAGATGCACCTCAACTCGAGTTGAGGTGCATCTTGACCACGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000363133    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012398.1-1370s21c1
Sequence:CCGGTCATGAGCAACACGGTCTTTCCTCGAGGAAAGACCGTGTTGCTCATGATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008844
VALIDATED
PIP5K1C MISSION shRNA Bacterial Glycerol Stock
phosphatidylinositol-4-phosphate 5-kinase, type I, gamma
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000274623    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008844.1-529s21c1
Sequence:CCGGCCGTCCAGATGACTATTTGTACTCGAGTACAAATAGTCATCTGGACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274622    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008844.1-1122s21c1
Sequence:CCGGTGGCCCAGAAGGCTCTGTATTCTCGAGAATACAGAGCCTTCTGGGCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000285712    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008844.1-275s21c1
Sequence:CCGGTCGGGAGAGACTACGTATAAGCTCGAGCTTATACGTAGTCTCTCCCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024529    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008844.1-823s1c1
Sequence:CCGGGCACCTTAAGTTCGACCTCAACTCGAGTTGAGGTCGAACTTAAGGTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024531    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008844.1-529s1c1
Sequence:CCGGCCGTCCAGATGACTATTTGTACTCGAGTACAAATAGTCATCTGGACGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024530    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008844.1-1961s1c1
Sequence:CCGGGCACCCTCTACAGACATCTATCTCGAGATAGATGTCTGTAGAGGGTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000285713    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008844.1-2053s21c1
Sequence:CCGGGAGCGACACATAACTTGTATGCTCGAGCATACAAGTTATGTGTCGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024533    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008844.1-1261s1c1
Sequence:CCGGCGGGATCATTGATATTCTGCACTCGAGTGCAGAATATCAATGATCCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274624    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008844.1-1261s21c1
Sequence:CCGGCGGGATCATTGATATTCTGCACTCGAGTGCAGAATATCAATGATCCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008844
VALIDATED
PIP5K1C MISSION shRNA shRNA Plasmid DNA
phosphatidylinositol-4-phosphate 5-kinase, type I, gamma
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000274623    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008844.1-529s21c1
Sequence:CCGGCCGTCCAGATGACTATTTGTACTCGAGTACAAATAGTCATCTGGACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274622    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008844.1-1122s21c1
Sequence:CCGGTGGCCCAGAAGGCTCTGTATTCTCGAGAATACAGAGCCTTCTGGGCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000285712    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008844.1-275s21c1
Sequence:CCGGTCGGGAGAGACTACGTATAAGCTCGAGCTTATACGTAGTCTCTCCCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024529    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008844.1-823s1c1
Sequence:CCGGGCACCTTAAGTTCGACCTCAACTCGAGTTGAGGTCGAACTTAAGGTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024531    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008844.1-529s1c1
Sequence:CCGGCCGTCCAGATGACTATTTGTACTCGAGTACAAATAGTCATCTGGACGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024530    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008844.1-1961s1c1
Sequence:CCGGGCACCCTCTACAGACATCTATCTCGAGATAGATGTCTGTAGAGGGTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000285713    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008844.1-2053s21c1
Sequence:CCGGGAGCGACACATAACTTGTATGCTCGAGCATACAAGTTATGTGTCGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024533    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008844.1-1261s1c1
Sequence:CCGGCGGGATCATTGATATTCTGCACTCGAGTGCAGAATATCAATGATCCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274624    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008844.1-1261s21c1
Sequence:CCGGCGGGATCATTGATATTCTGCACTCGAGTGCAGAATATCAATGATCCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008844
VALIDATED
PIP5K1C MISSION shRNA Lentiviral Transduction Particles
phosphatidylinositol-4-phosphate 5-kinase, type I, gamma
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000274623    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008844.1-529s21c1
Sequence:CCGGCCGTCCAGATGACTATTTGTACTCGAGTACAAATAGTCATCTGGACGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274622    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008844.1-1122s21c1
Sequence:CCGGTGGCCCAGAAGGCTCTGTATTCTCGAGAATACAGAGCCTTCTGGGCCATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000285712    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008844.1-275s21c1
Sequence:CCGGTCGGGAGAGACTACGTATAAGCTCGAGCTTATACGTAGTCTCTCCCGATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024529    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008844.1-823s1c1
Sequence:CCGGGCACCTTAAGTTCGACCTCAACTCGAGTTGAGGTCGAACTTAAGGTGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024531    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008844.1-529s1c1
Sequence:CCGGCCGTCCAGATGACTATTTGTACTCGAGTACAAATAGTCATCTGGACGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024530    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008844.1-1961s1c1
Sequence:CCGGGCACCCTCTACAGACATCTATCTCGAGATAGATGTCTGTAGAGGGTGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000285713    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008844.1-2053s21c1
Sequence:CCGGGAGCGACACATAACTTGTATGCTCGAGCATACAAGTTATGTGTCGCTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024533    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008844.1-1261s1c1
Sequence:CCGGCGGGATCATTGATATTCTGCACTCGAGTGCAGAATATCAATGATCCCGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274624    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008844.1-1261s21c1
Sequence:CCGGCGGGATCATTGATATTCTGCACTCGAGTGCAGAATATCAATGATCCCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)