EMAIL THIS PAGE TO A FRIEND

PIP

prolactin-induced protein

49 Gene Product Result for
Synonyms: GCDFP-15 GCDFP15 GPIP4
UniProtKB ID: P12273, A0A963, A0A9C3, A0A9F3, A4D2I1
Gene ID:
Mouse(18716) prolactin induced protein
Rat(64673) prolactin induced protein
cow(613853) prolactin-induced protein
domestic guinea pig(100379600) prolactin induced protein
Domestic Rabbit(100328927) prolactin-induced protein
dog(608856) prolactin-induced protein
Thale Cress(815913) proline iminopeptidase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008843 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008843 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008843 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002652 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002652 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002652 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU020471 MISSION® esiRNA esiRNA human PIP (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002652 Rosetta Predictions human pricing
NM_022708 Rosetta Predictions rat pricing
NM_008843 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002652 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00112654 predicted 295
2 SASI_Hs01_00112655 predicted 344
3 SASI_Hs02_00334194 predicted 263
4 SASI_Hs01_00112657 predicted 259
5 SASI_Hs01_00112658 predicted 259
6 SASI_Hs01_00112659 predicted 215
7 SASI_Hs01_00112660 predicted 258
8 SASI_Hs01_00112661 predicted 297
9 SASI_Hs01_00112662 predicted 260
10 SASI_Hs01_00112663 predicted 263
11 SASI_Hs01_00112656 predicted 276
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022708 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00118335 predicted 247
2 SASI_Rn01_00118336 predicted 322
3 SASI_Rn02_00263534 predicted 246
4 SASI_Rn01_00118337 predicted 235
5 SASI_Rn01_00118340 predicted 219
6 SASI_Rn01_00118341 predicted 300
7 SASI_Rn01_00118342 predicted 330
8 SASI_Rn01_00118343 predicted 237
9 SASI_Rn02_00263535 predicted 210
10 SASI_Rn02_00263536 predicted 205
11 SASI_Rn01_00118334 predicted 334
12 SASI_Rn01_00118338 predicted 280
13 SASI_Rn01_00118339 predicted 275
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008843 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00117183 predicted 320
2 SASI_Mm02_00314782 predicted 193
3 SASI_Mm01_00117185 predicted 336
4 SASI_Mm01_00117186 predicted 259
5 SASI_Mm01_00117187 predicted 268
6 SASI_Mm01_00117188 predicted 265
7 SASI_Mm01_00117189 predicted 347
8 SASI_Mm02_00314783 predicted 196
9 SASI_Mm01_00117190 predicted 262
10 SASI_Mm01_00117191 predicted 298
11 SASI_Mm01_00117184 predicted 266
12 SASI_Mm01_00117192 predicted 345
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008843
PIP MISSION shRNA Bacterial Glycerol Stock
prolactin-induced protein
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000258049    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008843.3-358s21c1
Sequence:CCGGATTTGCAACAGTGATTGATATCTCGAGATATCAATCACTGTTGCAAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250442    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008843.3-181s21c1
Sequence:CCGGGGAGATCACTGTGCAAGTTACCTCGAGGTAACTTGCACAGTGATCTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250439    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008843.3-264s21c1
Sequence:CCGGTGGAAGGTGCCTTCAACTATGCTCGAGCATAGTTGAAGGCACCTTCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250440    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008843.3-219s21c1
Sequence:CCGGGAGAATGTATGGTGATCAAAGCTCGAGCTTTGATCACCATACATTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250441    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008843.3-301s21c1
Sequence:CCGGCTGTAATGATCATCCTATTAGCTCGAGCTAATAGGATGATCATTACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008843
PIP MISSION shRNA shRNA Plasmid DNA
prolactin-induced protein
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000258049    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008843.3-358s21c1
Sequence:CCGGATTTGCAACAGTGATTGATATCTCGAGATATCAATCACTGTTGCAAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250442    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008843.3-181s21c1
Sequence:CCGGGGAGATCACTGTGCAAGTTACCTCGAGGTAACTTGCACAGTGATCTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250439    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008843.3-264s21c1
Sequence:CCGGTGGAAGGTGCCTTCAACTATGCTCGAGCATAGTTGAAGGCACCTTCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250440    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008843.3-219s21c1
Sequence:CCGGGAGAATGTATGGTGATCAAAGCTCGAGCTTTGATCACCATACATTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250441    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008843.3-301s21c1
Sequence:CCGGCTGTAATGATCATCCTATTAGCTCGAGCTAATAGGATGATCATTACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008843
PIP MISSION shRNA Lentiviral Transduction Particles
prolactin-induced protein
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000258049    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008843.3-358s21c1
Sequence:CCGGATTTGCAACAGTGATTGATATCTCGAGATATCAATCACTGTTGCAAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250442    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008843.3-181s21c1
Sequence:CCGGGGAGATCACTGTGCAAGTTACCTCGAGGTAACTTGCACAGTGATCTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250439    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008843.3-264s21c1
Sequence:CCGGTGGAAGGTGCCTTCAACTATGCTCGAGCATAGTTGAAGGCACCTTCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250440    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008843.3-219s21c1
Sequence:CCGGGAGAATGTATGGTGATCAAAGCTCGAGCTTTGATCACCATACATTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250441    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008843.3-301s21c1
Sequence:CCGGCTGTAATGATCATCCTATTAGCTCGAGCTAATAGGATGATCATTACAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002652
PIP MISSION shRNA Bacterial Glycerol Stock
prolactin-induced protein
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000135706    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002652.2-124s1c1
Sequence:CCGGGACAACACTCGGAAGATCATACTCGAGTATGATCTTCCGAGTGTTGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135482    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002652.2-199s1c1
Sequence:CCGGGTGCTTGCAGTTCAAACAGAACTCGAGTTCTGTTTGAACTGCAAGCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137374    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002652.2-157s1c1
Sequence:CCGGGACATTCCCAAGTCAGTACGTCTCGAGACGTACTGACTTGGGAATGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136808    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002652.2-250s1c1
Sequence:CCGGCTCATTAGCAGCATCCCTCTACTCGAGTAGAGGGATGCTGCTAATGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137188    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002652.2-367s1c1
Sequence:CCGGGCAGCCGTCGTTGATGTTATTCTCGAGAATAACATCAACGACGGCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137097    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002652.2-405s1c1
Sequence:CCGGCCCTGATGATGCTGCTGTAATCTCGAGATTACAGCAGCATCATCAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136606    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002652.2-361s1c1
Sequence:CCGGCAAATTGCAGCCGTCGTTGATCTCGAGATCAACGACGGCTGCAATTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000133853    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002652.2-222s1c1
Sequence:CCGGGAAAGAATGCATGGTGGTTAACTCGAGTTAACCACCATGCATTCTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135649    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002652.2-373s1c1
Sequence:CCGGGTCGTTGATGTTATTCGGGAACTCGAGTTCCCGAATAACATCAACGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002652
PIP MISSION shRNA shRNA Plasmid DNA
prolactin-induced protein
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000135706    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002652.2-124s1c1
Sequence:CCGGGACAACACTCGGAAGATCATACTCGAGTATGATCTTCCGAGTGTTGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135482    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002652.2-199s1c1
Sequence:CCGGGTGCTTGCAGTTCAAACAGAACTCGAGTTCTGTTTGAACTGCAAGCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000137374    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002652.2-157s1c1
Sequence:CCGGGACATTCCCAAGTCAGTACGTCTCGAGACGTACTGACTTGGGAATGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136808    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002652.2-250s1c1
Sequence:CCGGCTCATTAGCAGCATCCCTCTACTCGAGTAGAGGGATGCTGCTAATGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000137188    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002652.2-367s1c1
Sequence:CCGGGCAGCCGTCGTTGATGTTATTCTCGAGAATAACATCAACGACGGCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000137097    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002652.2-405s1c1
Sequence:CCGGCCCTGATGATGCTGCTGTAATCTCGAGATTACAGCAGCATCATCAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136606    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002652.2-361s1c1
Sequence:CCGGCAAATTGCAGCCGTCGTTGATCTCGAGATCAACGACGGCTGCAATTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000133853    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002652.2-222s1c1
Sequence:CCGGGAAAGAATGCATGGTGGTTAACTCGAGTTAACCACCATGCATTCTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135649    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002652.2-373s1c1
Sequence:CCGGGTCGTTGATGTTATTCGGGAACTCGAGTTCCCGAATAACATCAACGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002652
PIP MISSION shRNA Lentiviral Transduction Particles
prolactin-induced protein
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000135706    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002652.2-124s1c1
Sequence:CCGGGACAACACTCGGAAGATCATACTCGAGTATGATCTTCCGAGTGTTGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135482    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002652.2-199s1c1
Sequence:CCGGGTGCTTGCAGTTCAAACAGAACTCGAGTTCTGTTTGAACTGCAAGCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137374    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002652.2-157s1c1
Sequence:CCGGGACATTCCCAAGTCAGTACGTCTCGAGACGTACTGACTTGGGAATGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136808    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002652.2-250s1c1
Sequence:CCGGCTCATTAGCAGCATCCCTCTACTCGAGTAGAGGGATGCTGCTAATGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137188    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002652.2-367s1c1
Sequence:CCGGGCAGCCGTCGTTGATGTTATTCTCGAGAATAACATCAACGACGGCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137097    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002652.2-405s1c1
Sequence:CCGGCCCTGATGATGCTGCTGTAATCTCGAGATTACAGCAGCATCATCAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136606    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002652.2-361s1c1
Sequence:CCGGCAAATTGCAGCCGTCGTTGATCTCGAGATCAACGACGGCTGCAATTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000133853    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002652.2-222s1c1
Sequence:CCGGGAAAGAATGCATGGTGGTTAACTCGAGTTAACCACCATGCATTCTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135649    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002652.2-373s1c1
Sequence:CCGGGTCGTTGATGTTATTCGGGAACTCGAGTTCCCGAATAACATCAACGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)