EMAIL THIS PAGE TO A FRIEND

PIPOX

pipecolic acid oxidase

82 Gene Product Result for
Synonyms: LPIPOX
UniProtKB ID: Q9P0Z9, B3KNH0, Q96H28, Q9C070
Gene ID:
Mouse(19193) pipecolic acid oxidase
Rat(303272) pipecolic acid oxidase
Zebrafish(558601) pipecolic acid oxidase
chicken(771808) pipecolic acid oxidase
domestic cat(101094711) pipecolic acid oxidase
dog(491177) pipecolic acid oxidase
cow(509102) pipecolic acid oxidase
sheep(101108928) pipecolic acid oxidase
domestic guinea pig(100720520) pipecolic acid oxidase
Domestic Rabbit(100009239) pipecolic acid oxidase
naked mole-rat(101724480) pipecolic acid oxidase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008952 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008952 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008952 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_016518 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016518 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016518 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016518 Rosetta Predictions human pricing
NM_001012009 Rosetta Predictions rat pricing
XM_573147 Rosetta Predictions rat pricing
NM_008952 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016518 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00227389 predicted 1328
2 SASI_Hs01_00227390 predicted 853
3 SASI_Hs01_00227391 predicted 1395
4 SASI_Hs01_00227392 predicted 1345
5 SASI_Hs01_00227393 predicted 1264
6 SASI_Hs01_00227394 predicted 997
7 SASI_Hs01_00227395 predicted 514
8 SASI_Hs01_00227396 predicted 1223
9 SASI_Hs02_00349609 predicted 964
10 SASI_Hs01_00227397 predicted 903
11 SASI_Hs01_00227398 predicted 1199
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012009 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00056129 predicted 417
2 SASI_Rn02_00200087 predicted 1031
3 SASI_Rn01_00056130 predicted 1111
4 SASI_Rn01_00056131 predicted 813
5 SASI_Rn01_00056133 predicted 1086
6 SASI_Rn01_00056135 predicted 528
7 SASI_Rn01_00056136 predicted 1086
8 SASI_Rn01_00056137 predicted 676
9 SASI_Rn01_00056138 predicted 507
10 SASI_Rn02_00200088 predicted 390
11 SASI_Rn01_00056132 predicted 908
12 SASI_Rn01_00056134 predicted 738
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_573147 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00153455 predicted 1553
2 SASI_Rn01_00153456 predicted 1638
3 SASI_Rn01_00153457 predicted 1857
4 SASI_Rn01_00153458 predicted 1331
5 SASI_Rn01_00153459 predicted 1514
6 SASI_Rn01_00153460 predicted 1641
7 SASI_Rn01_00153461 predicted 1649
8 SASI_Rn01_00153462 predicted 1789
9 SASI_Rn01_00153463 predicted 1303
10 SASI_Rn01_00153464 predicted 1417
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008952 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00112544 predicted 1050
2 SASI_Mm01_00112545 predicted 788
3 SASI_Mm02_00315016 predicted 1361
4 SASI_Mm02_00315017 predicted 562
5 SASI_Mm01_00112547 predicted 988
6 SASI_Mm01_00112548 predicted 1088
7 SASI_Mm01_00112549 predicted 1163
8 SASI_Mm01_00112551 predicted 951
9 SASI_Mm02_00315018 predicted 273
10 SASI_Mm01_00112553 predicted 764
11 SASI_Mm01_00112546 predicted 476
12 SASI_Mm01_00112550 predicted 1091
13 SASI_Mm01_00112552 predicted 905
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008952
PIPOX MISSION shRNA Bacterial Glycerol Stock
pipecolic acid oxidase
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000076633    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008952.1-1318s1c1
Sequence:CCGGGCCTCCCTAGTCTATCTCATTCTCGAGAATGAGATAGACTAGGGAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076636    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008952.1-667s1c1
Sequence:CCGGCCTTAGGATCAATGTGTGTTACTCGAGTAACACACATTGATCCTAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076637    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008952.1-1004s1c1
Sequence:CCGGCACCCAAAGTATGACAACATTCTCGAGAATGTTGTCATACTTTGGGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076635    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008952.1-901s1c1
Sequence:CCGGCCACTTTGTCAGAGATCATTTCTCGAGAAATGATCTCTGACAAAGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076634    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008952.1-159s1c1
Sequence:CCGGGCCGCATAATCAGAAAGGCTTCTCGAGAAGCCTTTCTGATTATGCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008952
PIPOX MISSION shRNA shRNA Plasmid DNA
pipecolic acid oxidase
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000076633    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008952.1-1318s1c1
Sequence:CCGGGCCTCCCTAGTCTATCTCATTCTCGAGAATGAGATAGACTAGGGAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076636    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008952.1-667s1c1
Sequence:CCGGCCTTAGGATCAATGTGTGTTACTCGAGTAACACACATTGATCCTAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076637    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008952.1-1004s1c1
Sequence:CCGGCACCCAAAGTATGACAACATTCTCGAGAATGTTGTCATACTTTGGGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076635    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008952.1-901s1c1
Sequence:CCGGCCACTTTGTCAGAGATCATTTCTCGAGAAATGATCTCTGACAAAGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076634    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008952.1-159s1c1
Sequence:CCGGGCCGCATAATCAGAAAGGCTTCTCGAGAAGCCTTTCTGATTATGCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008952
PIPOX MISSION shRNA Lentiviral Transduction Particles
pipecolic acid oxidase
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000076633    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008952.1-1318s1c1
Sequence:CCGGGCCTCCCTAGTCTATCTCATTCTCGAGAATGAGATAGACTAGGGAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076636    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008952.1-667s1c1
Sequence:CCGGCCTTAGGATCAATGTGTGTTACTCGAGTAACACACATTGATCCTAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076637    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008952.1-1004s1c1
Sequence:CCGGCACCCAAAGTATGACAACATTCTCGAGAATGTTGTCATACTTTGGGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076635    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008952.1-901s1c1
Sequence:CCGGCCACTTTGTCAGAGATCATTTCTCGAGAAATGATCTCTGACAAAGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076634    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008952.1-159s1c1
Sequence:CCGGGCCGCATAATCAGAAAGGCTTCTCGAGAAGCCTTTCTGATTATGCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016518
PIPOX MISSION shRNA Bacterial Glycerol Stock
pipecolic acid oxidase
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000046133    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016518.1-1123s1c1
Sequence:CCGGCCTGTATGAATTAAGCATGAACTCGAGTTCATGCTTAATTCATACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046137    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016518.1-1042s1c1
Sequence:CCGGCCACCCAAAGTATGACAACATCTCGAGATGTTGTCATACTTTGGGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046136    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016518.1-187s1c1
Sequence:CCGGCCATGGACAAAGCCGGATAATCTCGAGATTATCCGGCTTTGTCCATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046134    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016518.1-622s1c1
Sequence:CCGGCCAAGCTAAGAGCTTGGTCATCTCGAGATGACCAAGCTCTTAGCTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046135    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016518.1-478s1c1
Sequence:CCGGCGGAGGAGTTATCTATGCATACTCGAGTATGCATAGATAACTCCTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417808    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016518.2-1807s21c1
Sequence:CCGGGGACGTTTGAGATGGGTATATCTCGAGATATACCCATCTCAAACGTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416762    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016518.2-1277s21c1
Sequence:CCGGGAGCTGCATGTACACGAATACCTCGAGGTATTCGTGTACATGCAGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016518
PIPOX MISSION shRNA shRNA Plasmid DNA
pipecolic acid oxidase
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000046133    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016518.1-1123s1c1
Sequence:CCGGCCTGTATGAATTAAGCATGAACTCGAGTTCATGCTTAATTCATACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046137    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016518.1-1042s1c1
Sequence:CCGGCCACCCAAAGTATGACAACATCTCGAGATGTTGTCATACTTTGGGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046136    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016518.1-187s1c1
Sequence:CCGGCCATGGACAAAGCCGGATAATCTCGAGATTATCCGGCTTTGTCCATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046134    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016518.1-622s1c1
Sequence:CCGGCCAAGCTAAGAGCTTGGTCATCTCGAGATGACCAAGCTCTTAGCTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046135    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016518.1-478s1c1
Sequence:CCGGCGGAGGAGTTATCTATGCATACTCGAGTATGCATAGATAACTCCTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417808    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016518.2-1807s21c1
Sequence:CCGGGGACGTTTGAGATGGGTATATCTCGAGATATACCCATCTCAAACGTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416762    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016518.2-1277s21c1
Sequence:CCGGGAGCTGCATGTACACGAATACCTCGAGGTATTCGTGTACATGCAGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016518
PIPOX MISSION shRNA Lentiviral Transduction Particles
pipecolic acid oxidase
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000046133    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016518.1-1123s1c1
Sequence:CCGGCCTGTATGAATTAAGCATGAACTCGAGTTCATGCTTAATTCATACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046137    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016518.1-1042s1c1
Sequence:CCGGCCACCCAAAGTATGACAACATCTCGAGATGTTGTCATACTTTGGGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046136    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016518.1-187s1c1
Sequence:CCGGCCATGGACAAAGCCGGATAATCTCGAGATTATCCGGCTTTGTCCATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046134    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016518.1-622s1c1
Sequence:CCGGCCAAGCTAAGAGCTTGGTCATCTCGAGATGACCAAGCTCTTAGCTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046135    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016518.1-478s1c1
Sequence:CCGGCGGAGGAGTTATCTATGCATACTCGAGTATGCATAGATAACTCCTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417808    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016518.2-1807s21c1
Sequence:CCGGGGACGTTTGAGATGGGTATATCTCGAGATATACCCATCTCAAACGTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416762    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016518.2-1277s21c1
Sequence:CCGGGAGCTGCATGTACACGAATACCTCGAGGTATTCGTGTACATGCAGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)