EMAIL THIS PAGE TO A FRIEND

PIR

pirin (iron-binding nuclear protein)

70 Gene Product Result for
UniProtKB ID: O00625, Q5U0G0, Q6FHD2
Gene ID:
Human(8544) Summary: This gene encodes a member of the cupin superfamily. The encoded protein is an Fe(II)-containing nuclear protein expressed in all tissues of the body and concentrated within dot-like subnuclear structures. Interactions with nuclear factor I/CCAAT box transcription factor as well as B cell lymphoma 3-encoded oncoprotein suggest the encoded protein may act as a transcriptional cofactor and be involved in the regulation of DNA transcription and replication. Alternatively spliced transcript variants have been described. [provided by RefSeq, Jul 2008]
Mouse(69656) pirin
Rat(363465) pirin (iron-binding nuclear protein)
dog(480846) pirin (iron-binding nuclear protein)
domestic cat(101095549) pirin (iron-binding nuclear protein)
naked mole-rat(101696483) pirin (iron-binding nuclear protein)
domestic guinea pig(100713331) pirin (iron-binding nuclear protein)
cow(790878) pirin (iron-binding nuclear protein)
sheep(101103375) pirin (iron-binding nuclear protein)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003662 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003662 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003662 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_027153 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027153 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027153 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001018109 Rosetta Predictions human pricing
NM_003662 Rosetta Predictions human pricing
NM_001009474 Rosetta Predictions rat pricing
NM_027153 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001018109 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00061521 predicted 670
2 SASI_Hs01_00061522 predicted 1008
3 SASI_Hs01_00061523 predicted 784
4 SASI_Hs01_00061524 predicted 534
5 SASI_Hs01_00061525 predicted 775
6 SASI_Hs01_00061526 predicted 581
7 SASI_Hs01_00061527 predicted 980
8 SASI_Hs01_00061528 predicted 744
9 SASI_Hs01_00061529 predicted 931
10 SASI_Hs02_00307027 predicted 755
11 SASI_Hs01_00061530 predicted 746
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003662 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00042752 predicted 709
2 SASI_Hs01_00042753 predicted 1041
3 SASI_Hs01_00042754 predicted 821
4 SASI_Hs01_00042755 predicted 567
5 SASI_Hs01_00042756 predicted 802
6 SASI_Hs01_00042757 predicted 615
7 SASI_Hs01_00042758 predicted 1016
8 SASI_Hs01_00042759 predicted 785
9 SASI_Hs01_00042760 predicted 968
10 SASI_Hs02_00336044 predicted 794
11 SASI_Hs01_00042761 predicted 779
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001009474 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00199551 predicted 604
2 SASI_Rn01_00066429 predicted 917
3 SASI_Rn01_00066430 predicted 623
4 SASI_Rn01_00066431 predicted 309
5 SASI_Rn01_00066432 predicted 250
6 SASI_Rn02_00199552 predicted 637
7 SASI_Rn01_00066434 predicted 673
8 SASI_Rn01_00066435 predicted 564
9 SASI_Rn01_00066436 predicted 471
10 SASI_Rn01_00066437 predicted 935
11 SASI_Rn01_00066428 predicted 707
12 SASI_Rn01_00066433 predicted 725
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027153 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00175886 predicted 739
2 SASI_Mm01_00175887 predicted 1049
3 SASI_Mm01_00175888 predicted 698
4 SASI_Mm02_00331669 predicted 773
5 SASI_Mm01_00175890 predicted 1035
6 SASI_Mm01_00175891 predicted 1244
7 SASI_Mm01_00175892 predicted 714
8 SASI_Mm01_00175893 predicted 804
9 SASI_Mm01_00175894 predicted 290
10 SASI_Mm01_00175895 predicted 348
11 SASI_Mm01_00175889 predicted 457
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003662
VALIDATED
PIR MISSION shRNA Bacterial Glycerol Stock
pirin (iron-binding nuclear protein)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000275003    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_003662.2-1131s21c1
Sequence:CCGGTCTTGATGTGTCCTAGAATTTCTCGAGAAATTCTAGGACACATCAAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274934    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_003662.2-970s21c1
Sequence:CCGGGCCATTAAGAGAACCAGTTATCTCGAGATAACTGGTTCTCTTAATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274932    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_003662.2-1001s21c1
Sequence:CCGGCCATTTGTGATGAACACCAATCTCGAGATTGGTGTTCATCACAAATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274933    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_003662.2-731s21c1
Sequence:CCGGACTCGCACACCAACCTTATATCTCGAGATATAAGGTTGGTGTGCGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274935    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_003662.2-577s21c1
Sequence:CCGGCCTACAACTGTGGGTTAATTTCTCGAGAAATTAACCCACAGTTGTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019258    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003662.1-378s1c1
Sequence:CCGGCCAGGAGGATTTCCTGATCATCTCGAGATGATCAGGAAATCCTCCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019257    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_003662.1-962s1c1
Sequence:CCGGGCCATTAAGAGAACCAGTTATCTCGAGATAACTGGTTCTCTTAATGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019254    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_003662.1-569s1c1
Sequence:CCGGCCTACAACTGTGGGTTAATTTCTCGAGAAATTAACCCACAGTTGTAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019256    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003662.1-699s1c1
Sequence:CCGGCTGGGAATAAAGTCCAAGGTTCTCGAGAACCTTGGACTTTATTCCCAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019255    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_003662.1-993s1c1
Sequence:CCGGCCATTTGTGATGAACACCAATCTCGAGATTGGTGTTCATCACAAATGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003662
VALIDATED
PIR MISSION shRNA shRNA Plasmid DNA
pirin (iron-binding nuclear protein)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000275003    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_003662.2-1131s21c1
Sequence:CCGGTCTTGATGTGTCCTAGAATTTCTCGAGAAATTCTAGGACACATCAAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274934    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_003662.2-970s21c1
Sequence:CCGGGCCATTAAGAGAACCAGTTATCTCGAGATAACTGGTTCTCTTAATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274932    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_003662.2-1001s21c1
Sequence:CCGGCCATTTGTGATGAACACCAATCTCGAGATTGGTGTTCATCACAAATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274933    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_003662.2-731s21c1
Sequence:CCGGACTCGCACACCAACCTTATATCTCGAGATATAAGGTTGGTGTGCGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274935    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_003662.2-577s21c1
Sequence:CCGGCCTACAACTGTGGGTTAATTTCTCGAGAAATTAACCCACAGTTGTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019258    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003662.1-378s1c1
Sequence:CCGGCCAGGAGGATTTCCTGATCATCTCGAGATGATCAGGAAATCCTCCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019257    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_003662.1-962s1c1
Sequence:CCGGGCCATTAAGAGAACCAGTTATCTCGAGATAACTGGTTCTCTTAATGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019254    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_003662.1-569s1c1
Sequence:CCGGCCTACAACTGTGGGTTAATTTCTCGAGAAATTAACCCACAGTTGTAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019256    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003662.1-699s1c1
Sequence:CCGGCTGGGAATAAAGTCCAAGGTTCTCGAGAACCTTGGACTTTATTCCCAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019255    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_003662.1-993s1c1
Sequence:CCGGCCATTTGTGATGAACACCAATCTCGAGATTGGTGTTCATCACAAATGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003662
VALIDATED
PIR MISSION shRNA Lentiviral Transduction Particles
pirin (iron-binding nuclear protein)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000275003    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_003662.2-1131s21c1
Sequence:CCGGTCTTGATGTGTCCTAGAATTTCTCGAGAAATTCTAGGACACATCAAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274934    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_003662.2-970s21c1
Sequence:CCGGGCCATTAAGAGAACCAGTTATCTCGAGATAACTGGTTCTCTTAATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274932    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_003662.2-1001s21c1
Sequence:CCGGCCATTTGTGATGAACACCAATCTCGAGATTGGTGTTCATCACAAATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274933    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_003662.2-731s21c1
Sequence:CCGGACTCGCACACCAACCTTATATCTCGAGATATAAGGTTGGTGTGCGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274935    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_003662.2-577s21c1
Sequence:CCGGCCTACAACTGTGGGTTAATTTCTCGAGAAATTAACCCACAGTTGTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019258    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003662.1-378s1c1
Sequence:CCGGCCAGGAGGATTTCCTGATCATCTCGAGATGATCAGGAAATCCTCCTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019257    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_003662.1-962s1c1
Sequence:CCGGGCCATTAAGAGAACCAGTTATCTCGAGATAACTGGTTCTCTTAATGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019254    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_003662.1-569s1c1
Sequence:CCGGCCTACAACTGTGGGTTAATTTCTCGAGAAATTAACCCACAGTTGTAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019256    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003662.1-699s1c1
Sequence:CCGGCTGGGAATAAAGTCCAAGGTTCTCGAGAACCTTGGACTTTATTCCCAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019255    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_003662.1-993s1c1
Sequence:CCGGCCATTTGTGATGAACACCAATCTCGAGATTGGTGTTCATCACAAATGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027153
PIR MISSION shRNA Bacterial Glycerol Stock
pirin (iron-binding nuclear protein)
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000217588    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027153.2-1022s1c1
Sequence:CCGGGTTGTCCAACATGGTCCATTTCTCGAGAAATGGACCATGTTGGACAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217355    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_027153.2-1252s1c1
Sequence:CCGGGTGATGCAGAGTCCTTTAATCCTCGAGGATTAAAGGACTCTGCATCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217462    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_027153.2-1221s1c1
Sequence:CCGGGTGCTTCTGAAGCCACATTAACTCGAGTTAATGTGGCTTCAGAAGCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175976    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027153.1-1061s1c1
Sequence:CCGGGAAATTTCTCAGGCCATTCTTCTCGAGAAGAATGGCCTGAGAAATTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174663    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027153.1-1045s1c1
Sequence:CCGGGATGAATACCAATGAGGAAATCTCGAGATTTCCTCATTGGTATTCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173806    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027153.1-788s1c1
Sequence:CCGGCTGGACTTCAAGTTGGACCAACTCGAGTTGGTCCAACTTGAAGTCCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194019    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027153.1-872s1c1
Sequence:CCGGGATGTATATATTGGGCCTGATCTCGAGATCAGGCCCAATATATACATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193437    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027153.1-1126s1c1
Sequence:CCGGGAAGTCAAAGATTGGAAACTACTCGAGTAGTTTCCAATCTTTGACTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193438    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027153.1-450s1c1
Sequence:CCGGGAGGATTTGAAACAGTATCTTCTCGAGAAGATACTGTTTCAAATCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027153
PIR MISSION shRNA shRNA Plasmid DNA
pirin (iron-binding nuclear protein)
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000217588    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027153.2-1022s1c1
Sequence:CCGGGTTGTCCAACATGGTCCATTTCTCGAGAAATGGACCATGTTGGACAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217355    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_027153.2-1252s1c1
Sequence:CCGGGTGATGCAGAGTCCTTTAATCCTCGAGGATTAAAGGACTCTGCATCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217462    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_027153.2-1221s1c1
Sequence:CCGGGTGCTTCTGAAGCCACATTAACTCGAGTTAATGTGGCTTCAGAAGCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175976    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027153.1-1061s1c1
Sequence:CCGGGAAATTTCTCAGGCCATTCTTCTCGAGAAGAATGGCCTGAGAAATTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000174663    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027153.1-1045s1c1
Sequence:CCGGGATGAATACCAATGAGGAAATCTCGAGATTTCCTCATTGGTATTCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000173806    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027153.1-788s1c1
Sequence:CCGGCTGGACTTCAAGTTGGACCAACTCGAGTTGGTCCAACTTGAAGTCCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194019    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027153.1-872s1c1
Sequence:CCGGGATGTATATATTGGGCCTGATCTCGAGATCAGGCCCAATATATACATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000193437    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027153.1-1126s1c1
Sequence:CCGGGAAGTCAAAGATTGGAAACTACTCGAGTAGTTTCCAATCTTTGACTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000193438    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027153.1-450s1c1
Sequence:CCGGGAGGATTTGAAACAGTATCTTCTCGAGAAGATACTGTTTCAAATCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027153
PIR MISSION shRNA Lentiviral Transduction Particles
pirin (iron-binding nuclear protein)
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000217588    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027153.2-1022s1c1
Sequence:CCGGGTTGTCCAACATGGTCCATTTCTCGAGAAATGGACCATGTTGGACAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217355    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_027153.2-1252s1c1
Sequence:CCGGGTGATGCAGAGTCCTTTAATCCTCGAGGATTAAAGGACTCTGCATCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217462    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_027153.2-1221s1c1
Sequence:CCGGGTGCTTCTGAAGCCACATTAACTCGAGTTAATGTGGCTTCAGAAGCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175976    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027153.1-1061s1c1
Sequence:CCGGGAAATTTCTCAGGCCATTCTTCTCGAGAAGAATGGCCTGAGAAATTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174663    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027153.1-1045s1c1
Sequence:CCGGGATGAATACCAATGAGGAAATCTCGAGATTTCCTCATTGGTATTCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173806    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027153.1-788s1c1
Sequence:CCGGCTGGACTTCAAGTTGGACCAACTCGAGTTGGTCCAACTTGAAGTCCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194019    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027153.1-872s1c1
Sequence:CCGGGATGTATATATTGGGCCTGATCTCGAGATCAGGCCCAATATATACATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193437    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027153.1-1126s1c1
Sequence:CCGGGAAGTCAAAGATTGGAAACTACTCGAGTAGTTTCCAATCTTTGACTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193438    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027153.1-450s1c1
Sequence:CCGGGAGGATTTGAAACAGTATCTTCTCGAGAAGATACTGTTTCAAATCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)