EMAIL THIS PAGE TO A FRIEND

PIRT

phosphoinositide-interacting regulator of transient receptor potential channels

46 Gene Product Result for
UniProtKB ID: P0C851, B7Z648
Gene ID:
Mouse(193003) phosphoinositide-interacting regulator of transient receptor potential channels
Rat(497929) phosphoinositide-interacting regulator of transient receptor potential channels
chicken(100857284) phosphoinositide-interacting regulator of transient receptor potential channels
dog(100686498) phosphoinositide-interacting regulator of transient receptor potential channels
domestic cat(101085672) phosphoinositide-interacting regulator of transient receptor potential channels
cow(100140752) phosphoinositide-interacting regulator of transient receptor potential channels
sheep(101103908) phosphoinositide-interacting regulator of transient receptor potential channels
domestic guinea pig(100724638) phosphoinositide-interacting regulator of transient receptor potential channels
naked mole-rat(101702356) phosphoinositide-interacting regulator of transient receptor potential channels
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_178656 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178656 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178656 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001101387 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001101387 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001101387 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001101387 Rosetta Predictions human pricing
XM_927351 Rosetta Predictions human pricing
NM_001109032 Rosetta Predictions rat pricing
NM_178656 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001101387 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00322752 predicted 690
2 SASI_Hs02_00322753 predicted 1007
3 SASI_Hs02_00322754 predicted 647
4 SASI_Hs02_00322755 predicted 1202
5 SASI_Hs02_00322756 predicted 404
6 SASI_Hs02_00322757 predicted 1050
7 SASI_Hs02_00322758 predicted 680
8 SASI_Hs02_00322759 predicted 703
9 SASI_Hs02_00322760 predicted 889
10 SASI_Hs02_00322761 predicted 454
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_927351 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00253907 predicted 717
2 SASI_Hs01_00253908 predicted 766
3 SASI_Hs01_00253909 predicted 741
4 SASI_Hs01_00253910 predicted 800
5 SASI_Hs01_00253911 predicted 740
6 SASI_Hs01_00253912 predicted 794
7 SASI_Hs01_00253913 predicted 805
8 SASI_Hs01_00253914 predicted 684
9 SASI_Hs01_00253915 predicted 725
10 SASI_Hs01_00253916 predicted 775
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109032 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00244504 predicted 208
2 SASI_Rn02_00244505 predicted 326
3 SASI_Rn02_00244506 predicted 357
4 SASI_Rn02_00244507 predicted 306
5 SASI_Rn02_00244508 predicted 329
6 SASI_Rn02_00244509 predicted 386
7 SASI_Rn02_00244510 predicted 278
8 SASI_Rn02_00244511 predicted 334
9 SASI_Rn02_00244512 predicted 383
10 SASI_Rn02_00244513 predicted 262
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178656 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00079484 predicted 895
2 SASI_Mm01_00079485 predicted 741
3 SASI_Mm01_00079486 predicted 345
4 SASI_Mm01_00079487 predicted 577
5 SASI_Mm02_00349088 predicted 707
6 SASI_Mm01_00079488 predicted 918
7 SASI_Mm01_00079489 predicted 981
8 SASI_Mm01_00079491 predicted 1030
9 SASI_Mm01_00079492 predicted 725
10 SASI_Mm01_00079493 predicted 730
11 SASI_Mm01_00079490 predicted 409
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178656
PIRT MISSION shRNA Bacterial Glycerol Stock
phosphoinositide-interacting regulator of transient receptor potential channels
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000266830    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178656.3-569s21c1
Sequence:CCGGTTCCTCCTGAACCGCTGATGACTCGAGTCATCAGCGGTTCAGGAGGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217400    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178656.3-2473s1c1
Sequence:CCGGGAGACTGACTCCCTAACTAAACTCGAGTTTAGTTAGGGAGTCAGTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200740    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178656.2-414s1c1
Sequence:CCGGGAGAAGCATAAAGTTGTGCAACTCGAGTTGCACAACTTTATGCTTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000283330    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178656.3-323s21c1
Sequence:CCGGATCTACCACAAGCCCATCATCCTCGAGGATGATGGGCTTGTGGTAGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000266829    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178656.3-1539s21c1
Sequence:CCGGCTACCAAACAAGCAAGTATTTCTCGAGAAATACTTGCTTGTTTGGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000266831    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178656.3-429s21c1
Sequence:CCGGTGCAAGTGCTCAGGATGATAGCTCGAGCTATCATCCTGAGCACTTGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178656
PIRT MISSION shRNA shRNA Plasmid DNA
phosphoinositide-interacting regulator of transient receptor potential channels
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000266830    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178656.3-569s21c1
Sequence:CCGGTTCCTCCTGAACCGCTGATGACTCGAGTCATCAGCGGTTCAGGAGGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217400    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178656.3-2473s1c1
Sequence:CCGGGAGACTGACTCCCTAACTAAACTCGAGTTTAGTTAGGGAGTCAGTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000200740    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178656.2-414s1c1
Sequence:CCGGGAGAAGCATAAAGTTGTGCAACTCGAGTTGCACAACTTTATGCTTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000283330    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178656.3-323s21c1
Sequence:CCGGATCTACCACAAGCCCATCATCCTCGAGGATGATGGGCTTGTGGTAGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000266829    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178656.3-1539s21c1
Sequence:CCGGCTACCAAACAAGCAAGTATTTCTCGAGAAATACTTGCTTGTTTGGTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000266831    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178656.3-429s21c1
Sequence:CCGGTGCAAGTGCTCAGGATGATAGCTCGAGCTATCATCCTGAGCACTTGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178656
PIRT MISSION shRNA Lentiviral Transduction Particles
phosphoinositide-interacting regulator of transient receptor potential channels
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000266830    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178656.3-569s21c1
Sequence:CCGGTTCCTCCTGAACCGCTGATGACTCGAGTCATCAGCGGTTCAGGAGGAATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000217400    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178656.3-2473s1c1
Sequence:CCGGGAGACTGACTCCCTAACTAAACTCGAGTTTAGTTAGGGAGTCAGTCTCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000200740    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178656.2-414s1c1
Sequence:CCGGGAGAAGCATAAAGTTGTGCAACTCGAGTTGCACAACTTTATGCTTCTCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000283330    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178656.3-323s21c1
Sequence:CCGGATCTACCACAAGCCCATCATCCTCGAGGATGATGGGCTTGTGGTAGATTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000266829    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178656.3-1539s21c1
Sequence:CCGGCTACCAAACAAGCAAGTATTTCTCGAGAAATACTTGCTTGTTTGGTAGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000266831    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178656.3-429s21c1
Sequence:CCGGTGCAAGTGCTCAGGATGATAGCTCGAGCTATCATCCTGAGCACTTGCATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001101387
PIRT MISSION shRNA Bacterial Glycerol Stock
phosphoinositide-interacting regulator of transient receptor potential channels
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000256772    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101387.1-448s21c1
Sequence:CCGGCTACCGCAAGCCCATCGTTATCTCGAGATAACGATGGGCTTGCGGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256771    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101387.1-652s21c1
Sequence:CCGGGCACAGACAGAAGTCGAATTTCTCGAGAAATTCGACTTCTGTCTGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256770    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001101387.1-2788s21c1
Sequence:CCGGCAGATTTGATGGCCCTATAATCTCGAGATTATAGGGCCATCAAATCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256769    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101387.1-699s21c1
Sequence:CCGGTGACTCGCTGATGGTGGTTTCCTCGAGGAAACCACCATCAGCGAGTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000281493    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101387.1-676s21c1
Sequence:CCGGACGCAGCCTCAAGTCCTTCTTCTCGAGAAGAAGGACTTGAGGCTGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001101387
PIRT MISSION shRNA shRNA Plasmid DNA
phosphoinositide-interacting regulator of transient receptor potential channels
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000256772    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101387.1-448s21c1
Sequence:CCGGCTACCGCAAGCCCATCGTTATCTCGAGATAACGATGGGCTTGCGGTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256771    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101387.1-652s21c1
Sequence:CCGGGCACAGACAGAAGTCGAATTTCTCGAGAAATTCGACTTCTGTCTGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256770    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001101387.1-2788s21c1
Sequence:CCGGCAGATTTGATGGCCCTATAATCTCGAGATTATAGGGCCATCAAATCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256769    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101387.1-699s21c1
Sequence:CCGGTGACTCGCTGATGGTGGTTTCCTCGAGGAAACCACCATCAGCGAGTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000281493    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101387.1-676s21c1
Sequence:CCGGACGCAGCCTCAAGTCCTTCTTCTCGAGAAGAAGGACTTGAGGCTGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001101387
PIRT MISSION shRNA Lentiviral Transduction Particles
phosphoinositide-interacting regulator of transient receptor potential channels
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000256772    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101387.1-448s21c1
Sequence:CCGGCTACCGCAAGCCCATCGTTATCTCGAGATAACGATGGGCTTGCGGTAGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000256771    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101387.1-652s21c1
Sequence:CCGGGCACAGACAGAAGTCGAATTTCTCGAGAAATTCGACTTCTGTCTGTGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000256770    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001101387.1-2788s21c1
Sequence:CCGGCAGATTTGATGGCCCTATAATCTCGAGATTATAGGGCCATCAAATCTGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000256769    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101387.1-699s21c1
Sequence:CCGGTGACTCGCTGATGGTGGTTTCCTCGAGGAAACCACCATCAGCGAGTCATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000281493    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101387.1-676s21c1
Sequence:CCGGACGCAGCCTCAAGTCCTTCTTCTCGAGAAGAAGGACTTGAGGCTGCGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???