EMAIL THIS PAGE TO A FRIEND

PISD

phosphatidylserine decarboxylase

92 Gene Product Result for
Synonyms: DJ858B16 PSD PSDC PSSC dJ858B16.2
Gene ID:
Human(23761) Summary: Phosphatidylserine decarboxylases (PSDs; EC 4.1.1.65) catalyze the formation of phosphatidylethanolamine (PE) by decarboxylation of phosphatidylserine (PS). Type I PSDs, such as PISD, are targeted to the inner mitochondrial membrane by an N-terminal targeting sequence. PISD also contains a conserved LGST motif that functions as an autocatalytic cleavage site where the proenzyme is split into mature alpha and beta subunits (Schuiki and Daum, 2009 [PubMed 19165886]
Mouse(320951) phosphatidylserine decarboxylase
Rat(681361) phosphatidylserine decarboxylase
Zebrafish(553433) phosphatidylserine decarboxylase
domestic cat(101099405) phosphatidylserine decarboxylase
dog(477544) phosphatidylserine decarboxylase
chicken(416960) phosphatidylserine decarboxylase
cow(505332) phosphatidylserine decarboxylase
sheep(101116767) phosphatidylserine decarboxylase
naked mole-rat(101703801) phosphatidylserine decarboxylase
Domestic Rabbit(100328732) phosphatidylserine decarboxylase
domestic guinea pig(100729215) phosphatidylserine decarboxylase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_177298 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177298 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177298 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_014338 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014338 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014338 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014338 Rosetta Predictions human pricing
XM_001061408 Rosetta Predictions rat pricing
NM_177298 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014338 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00345479 predicted 659
2 SASI_Hs01_00247504 predicted 1857
3 SASI_Hs01_00247505 predicted 736
4 SASI_Hs01_00247506 predicted 631
5 SASI_Hs01_00247507 predicted 741
6 SASI_Hs02_00345480 predicted 1383
7 SASI_Hs01_00247509 predicted 1808
8 SASI_Hs01_00247510 predicted 1190
9 SASI_Hs01_00247511 predicted 1678
10 SASI_Hs01_00247512 predicted 1670
11 SASI_Hs01_00247508 predicted 1356
12 SASI_Hs01_00247513 predicted 827
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001061408 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00299975 predicted 848
2 SASI_Rn02_00299976 predicted 830
3 SASI_Rn02_00299977 predicted 1357
4 SASI_Rn02_00299978 predicted 1088
5 SASI_Rn02_00299979 predicted 343
6 SASI_Rn02_00299980 predicted 1051
7 SASI_Rn02_00299981 predicted 1096
8 SASI_Rn02_00299982 predicted 1412
9 SASI_Rn02_00299983 predicted 979
10 SASI_Rn02_00299984 predicted 1320
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177298 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00081759 predicted 1648
2 SASI_Mm01_00081761 predicted 1699
3 SASI_Mm01_00081762 predicted 121
4 SASI_Mm01_00081763 predicted 86
5 SASI_Mm01_00081764 predicted 79
6 SASI_Mm01_00081765 predicted 157
7 SASI_Mm01_00081758 predicted 1050
8 SASI_Mm01_00081760 predicted 1052
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177298
PISD MISSION shRNA Bacterial Glycerol Stock
phosphatidylserine decarboxylase
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000436785    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177298.3-991s21c1
Sequence:CCGGCCGTATCCACTTTGACCGAGACTCGAGTCTCGGTCAAAGTGGATACGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417136    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177298.3-124s21c1
Sequence:CCGGCTTACAGAAATTGCCTCTTCACTCGAGTGAAGAGGCAATTTCTGTAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115414    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177298.2-82s1c1
Sequence:CCGGCCCTGTCACTATGAATCTACTCTCGAGAGTAGATTCATAGTGACAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115415    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177298.2-149s1c1
Sequence:CCGGCAGGTGTCAGAAATTTCCATACTCGAGTATGGAAATTTCTGACACCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115411    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177298.2-1725s1c1
Sequence:CCGGCCAGTGTCTTCTGAGGACAATCTCGAGATTGTCCTCAGAAGACACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115413    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177298.2-250s1c1
Sequence:CCGGCAGTATGAGAAGTACAGGGAACTCGAGTTCCCTGTACTTCTCATACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115412    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177298.2-1048s1c1
Sequence:CCGGTCCTACAATGACCTGAGCTTTCTCGAGAAAGCTCAGGTCATTGTAGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177298
PISD MISSION shRNA shRNA Plasmid DNA
phosphatidylserine decarboxylase
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000436785    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177298.3-991s21c1
Sequence:CCGGCCGTATCCACTTTGACCGAGACTCGAGTCTCGGTCAAAGTGGATACGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417136    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177298.3-124s21c1
Sequence:CCGGCTTACAGAAATTGCCTCTTCACTCGAGTGAAGAGGCAATTTCTGTAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000115414    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177298.2-82s1c1
Sequence:CCGGCCCTGTCACTATGAATCTACTCTCGAGAGTAGATTCATAGTGACAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000115415    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177298.2-149s1c1
Sequence:CCGGCAGGTGTCAGAAATTTCCATACTCGAGTATGGAAATTTCTGACACCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000115411    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177298.2-1725s1c1
Sequence:CCGGCCAGTGTCTTCTGAGGACAATCTCGAGATTGTCCTCAGAAGACACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000115413    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177298.2-250s1c1
Sequence:CCGGCAGTATGAGAAGTACAGGGAACTCGAGTTCCCTGTACTTCTCATACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000115412    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177298.2-1048s1c1
Sequence:CCGGTCCTACAATGACCTGAGCTTTCTCGAGAAAGCTCAGGTCATTGTAGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177298
PISD MISSION shRNA Lentiviral Transduction Particles
phosphatidylserine decarboxylase
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000436785    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177298.3-991s21c1
Sequence:CCGGCCGTATCCACTTTGACCGAGACTCGAGTCTCGGTCAAAGTGGATACGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417136    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177298.3-124s21c1
Sequence:CCGGCTTACAGAAATTGCCTCTTCACTCGAGTGAAGAGGCAATTTCTGTAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115414    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177298.2-82s1c1
Sequence:CCGGCCCTGTCACTATGAATCTACTCTCGAGAGTAGATTCATAGTGACAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115415    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177298.2-149s1c1
Sequence:CCGGCAGGTGTCAGAAATTTCCATACTCGAGTATGGAAATTTCTGACACCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115411    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177298.2-1725s1c1
Sequence:CCGGCCAGTGTCTTCTGAGGACAATCTCGAGATTGTCCTCAGAAGACACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115413    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177298.2-250s1c1
Sequence:CCGGCAGTATGAGAAGTACAGGGAACTCGAGTTCCCTGTACTTCTCATACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115412    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177298.2-1048s1c1
Sequence:CCGGTCCTACAATGACCTGAGCTTTCTCGAGAAAGCTCAGGTCATTGTAGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014338
PISD MISSION shRNA Bacterial Glycerol Stock
phosphatidylserine decarboxylase
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000416538    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014338.3-1806s21c1
Sequence:CCGGGAATGATCTCAGTCACATTTGCTCGAGCAAATGTGACTGAGATCATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414132    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014338.3-1770s21c1
Sequence:CCGGCCGTTCCTTCTGCCTACAAATCTCGAGATTTGTAGGCAGAAGGAACGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078463    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014338.3-2354s1c1
Sequence:CCGGCCCTACATGAAATATGGGAAACTCGAGTTTCCCATATTTCATGTAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078464    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014338.3-749s1c1
Sequence:CCGGAGCCTGTACATCTGGACGTTTCTCGAGAAACGTCCAGATGTACAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078465    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014338.3-1363s1c1
Sequence:CCGGCAAGGGCTCCTACAATGACTTCTCGAGAAGTCATTGTAGGAGCCCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078466    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014338.3-899s1c1
Sequence:CCGGGATGGAAGGATCCTCAACTTTCTCGAGAAAGTTGAGGATCCTTCCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014338
PISD MISSION shRNA shRNA Plasmid DNA
phosphatidylserine decarboxylase
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000416538    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014338.3-1806s21c1
Sequence:CCGGGAATGATCTCAGTCACATTTGCTCGAGCAAATGTGACTGAGATCATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414132    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014338.3-1770s21c1
Sequence:CCGGCCGTTCCTTCTGCCTACAAATCTCGAGATTTGTAGGCAGAAGGAACGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078463    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014338.3-2354s1c1
Sequence:CCGGCCCTACATGAAATATGGGAAACTCGAGTTTCCCATATTTCATGTAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078464    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014338.3-749s1c1
Sequence:CCGGAGCCTGTACATCTGGACGTTTCTCGAGAAACGTCCAGATGTACAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078465    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014338.3-1363s1c1
Sequence:CCGGCAAGGGCTCCTACAATGACTTCTCGAGAAGTCATTGTAGGAGCCCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078466    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014338.3-899s1c1
Sequence:CCGGGATGGAAGGATCCTCAACTTTCTCGAGAAAGTTGAGGATCCTTCCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014338
PISD MISSION shRNA Lentiviral Transduction Particles
phosphatidylserine decarboxylase
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000416538    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014338.3-1806s21c1
Sequence:CCGGGAATGATCTCAGTCACATTTGCTCGAGCAAATGTGACTGAGATCATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414132    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014338.3-1770s21c1
Sequence:CCGGCCGTTCCTTCTGCCTACAAATCTCGAGATTTGTAGGCAGAAGGAACGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078463    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014338.3-2354s1c1
Sequence:CCGGCCCTACATGAAATATGGGAAACTCGAGTTTCCCATATTTCATGTAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078464    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014338.3-749s1c1
Sequence:CCGGAGCCTGTACATCTGGACGTTTCTCGAGAAACGTCCAGATGTACAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078465    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014338.3-1363s1c1
Sequence:CCGGCAAGGGCTCCTACAATGACTTCTCGAGAAGTCATTGTAGGAGCCCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078466    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014338.3-899s1c1
Sequence:CCGGGATGGAAGGATCCTCAACTTTCTCGAGAAAGTTGAGGATCCTTCCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)