EMAIL THIS PAGE TO A FRIEND

PITPNA

phosphatidylinositol transfer protein, alpha

185 Gene Product Result for
Synonyms: PI-TPalpha PITPN VIB1A
UniProtKB ID: Q00169
Gene ID:
Human(5306) Summary: This gene encodes a member of a family of lipid-binding proteins that transfer molecules of phosphatidylinositol or phosphatidylcholine between membrane surfaces. The protein is implicated in phospholipase C signaling and in the production of phosphatidylinositol 3,4,5-trisphosphate (PIP3) by phosphoinositide-3-kinase.[provided by RefSeq, Sep 2009]
Mouse(18738) phosphatidylinositol transfer protein, alpha
Rat(29525) phosphatidylinositol transfer protein, alpha
dog(480648) phosphatidylinositol transfer protein, alpha
domestic cat(101085584) phosphatidylinositol transfer protein, alpha
cow(616550) phosphatidylinositol transfer protein, alpha
sheep(101116240) phosphatidylinositol transfer protein, alpha
naked mole-rat(101720349) phosphatidylinositol transfer protein, alpha
Domestic Rabbit(100328961) phosphatidylinositol transfer protein, alpha
domestic guinea pig(100713837) phosphatidylinositol transfer protein, alpha
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2107682 Anti-PITPNA antibody produced in rabbit affinity isolated antibody dog, human, pig, rabbit, rat, bovine, horse, mouse
western blot pricing
SAB1400211 Monoclonal Anti-PITPNA antibody produced in mouse clone 4G10, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008850 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008850 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008850 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006224 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006224 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006224 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006224 Rosetta Predictions human pricing
NM_017231 Rosetta Predictions rat pricing
NM_008850 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006224 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00341136 predicted 1042
2 SASI_Hs01_00070346 predicted 536
3 SASI_Hs01_00070347 predicted 599
4 SASI_Hs01_00070348 predicted 821
5 SASI_Hs01_00070349 predicted 644
6 SASI_Hs01_00070350 predicted 443
7 SASI_Hs01_00070351 predicted 896
8 SASI_Hs01_00070352 predicted 560
9 SASI_Hs02_00341137 predicted 1339
10 SASI_Hs02_00341138 predicted 1337
11 SASI_Hs01_00070343 predicted 1171
12 SASI_Hs01_00070344 predicted 918
13 SASI_Hs01_00070345 predicted 856
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017231 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00054221 predicted 760
2 SASI_Rn02_00261597 predicted 870
3 SASI_Rn01_00054223 predicted 383
4 SASI_Rn01_00054224 predicted 460
5 SASI_Rn01_00054225 predicted 600
6 SASI_Rn01_00054226 predicted 589
7 SASI_Rn01_00054227 predicted 842
8 SASI_Rn01_00054228 predicted 474
9 SASI_Rn01_00054229 predicted 493
10 SASI_Rn01_00054230 predicted 719
11 SASI_Rn01_00054222 predicted 782
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008850 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00113680 predicted 508
2 SASI_Mm01_00113681 predicted 397
3 SASI_Mm01_00113682 predicted 499
4 SASI_Mm01_00113683 predicted 629
5 SASI_Mm01_00113684 predicted 1205
6 SASI_Mm01_00113685 predicted 663
7 SASI_Mm01_00113686 predicted 753
8 SASI_Mm01_00113687 predicted 883
9 SASI_Mm01_00113688 predicted 1183
10 SASI_Mm01_00113689 predicted 909
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008850
VALIDATED
PITPNA MISSION shRNA Bacterial Glycerol Stock
phosphatidylinositol transfer protein, alpha
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000311918    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008850.1-466s21c1
Sequence:CCGGGCCCTGAATATACACGAGAAACTCGAGTTTCTCGTGTATATTCAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311920    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008850.1-763s21c1
Sequence:CCGGCAAGAACTTGTCAATCAGAAACTCGAGTTTCTGATTGACAAGTTCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100636    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_008850.1-466s1c1
Sequence:CCGGGCCCTGAATATACACGAGAAACTCGAGTTTCTCGTGTATATTCAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311921    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008850.1-919s21c1
Sequence:CCGGTGGCTCGATAAATGGGTTGATCTCGAGATCAACCCATTTATCGAGCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311919    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008850.1-669s21c1
Sequence:CCGGCCAAGTACTTAGCAAGGATTACTCGAGTAATCCTTGCTAAGTACTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100637    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_008850.1-763s1c1
Sequence:CCGGCAAGAACTTGTCAATCAGAAACTCGAGTTTCTGATTGACAAGTTCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100635    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008850.1-2735s1c1
Sequence:CCGGGCTCTGTATTACCTATCAAATCTCGAGATTTGATAGGTAATACAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100639    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_008850.1-919s1c1
Sequence:CCGGTGGCTCGATAAATGGGTTGATCTCGAGATCAACCCATTTATCGAGCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100638    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_008850.1-669s1c1
Sequence:CCGGCCAAGTACTTAGCAAGGATTACTCGAGTAATCCTTGCTAAGTACTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008850
VALIDATED
PITPNA MISSION shRNA shRNA Plasmid DNA
phosphatidylinositol transfer protein, alpha
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000311918    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008850.1-466s21c1
Sequence:CCGGGCCCTGAATATACACGAGAAACTCGAGTTTCTCGTGTATATTCAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000311920    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008850.1-763s21c1
Sequence:CCGGCAAGAACTTGTCAATCAGAAACTCGAGTTTCTGATTGACAAGTTCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100636    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_008850.1-466s1c1
Sequence:CCGGGCCCTGAATATACACGAGAAACTCGAGTTTCTCGTGTATATTCAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000311921    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008850.1-919s21c1
Sequence:CCGGTGGCTCGATAAATGGGTTGATCTCGAGATCAACCCATTTATCGAGCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000311919    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008850.1-669s21c1
Sequence:CCGGCCAAGTACTTAGCAAGGATTACTCGAGTAATCCTTGCTAAGTACTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100637    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_008850.1-763s1c1
Sequence:CCGGCAAGAACTTGTCAATCAGAAACTCGAGTTTCTGATTGACAAGTTCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100635    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008850.1-2735s1c1
Sequence:CCGGGCTCTGTATTACCTATCAAATCTCGAGATTTGATAGGTAATACAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100639    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_008850.1-919s1c1
Sequence:CCGGTGGCTCGATAAATGGGTTGATCTCGAGATCAACCCATTTATCGAGCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100638    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_008850.1-669s1c1
Sequence:CCGGCCAAGTACTTAGCAAGGATTACTCGAGTAATCCTTGCTAAGTACTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008850
VALIDATED
PITPNA MISSION shRNA Lentiviral Transduction Particles
phosphatidylinositol transfer protein, alpha
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000311918    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008850.1-466s21c1
Sequence:CCGGGCCCTGAATATACACGAGAAACTCGAGTTTCTCGTGTATATTCAGGGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000311920    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008850.1-763s21c1
Sequence:CCGGCAAGAACTTGTCAATCAGAAACTCGAGTTTCTGATTGACAAGTTCTTGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000100636    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_008850.1-466s1c1
Sequence:CCGGGCCCTGAATATACACGAGAAACTCGAGTTTCTCGTGTATATTCAGGGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000311921    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008850.1-919s21c1
Sequence:CCGGTGGCTCGATAAATGGGTTGATCTCGAGATCAACCCATTTATCGAGCCATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000311919    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008850.1-669s21c1
Sequence:CCGGCCAAGTACTTAGCAAGGATTACTCGAGTAATCCTTGCTAAGTACTTGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000100637    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_008850.1-763s1c1
Sequence:CCGGCAAGAACTTGTCAATCAGAAACTCGAGTTTCTGATTGACAAGTTCTTGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000100635    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008850.1-2735s1c1
Sequence:CCGGGCTCTGTATTACCTATCAAATCTCGAGATTTGATAGGTAATACAGAGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000100639    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_008850.1-919s1c1
Sequence:CCGGTGGCTCGATAAATGGGTTGATCTCGAGATCAACCCATTTATCGAGCCATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000100638    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_008850.1-669s1c1
Sequence:CCGGCCAAGTACTTAGCAAGGATTACTCGAGTAATCCTTGCTAAGTACTTGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006224
VALIDATED
PITPNA MISSION shRNA Bacterial Glycerol Stock
phosphatidylinositol transfer protein, alpha
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000299703    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_006224.3-790s21c1
Sequence:CCGGGCAAGAGCTTGTAAACCAGAACTCGAGTTCTGGTTTACAAGCTCTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299704    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_006224.3-290s21c1
Sequence:CCGGCCTGTGTCTGTAGATGAGTATCTCGAGATACTCATCTACAGACACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299702    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_006224.3-871s21c1
Sequence:CCGGGCAGAACAAAGTGGAGAACTTCTCGAGAAGTTCTCCACTTTGTTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299705    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006224.3-449s21c1
Sequence:CCGGCAGAGCAAAGTACCCACGTTTCTCGAGAAACGTGGGTACTTTGCTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059795    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006224.2-846s1c1
Sequence:CCGGGCAGAACAAAGTGGAGAACTTCTCGAGAAGTTCTCCACTTTGTTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059797    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_006224.2-765s1c1
Sequence:CCGGGCAAGAGCTTGTAAACCAGAACTCGAGTTCTGGTTTACAAGCTCTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006224.2-265s1c1
Sequence:CCGGCCTGTGTCTGTAGATGAGTATCTCGAGATACTCATCTACAGACACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059793    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006224.2-912s1c1
Sequence:CCGGGCTGTTCTGTTGGCTCGATAACTCGAGTTATCGAGCCAACAGAACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000310486    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_006224.3-937s21c1
Sequence:CCGGGCTGTTCTGTTGGCTCGATAACTCGAGTTATCGAGCCAACAGAACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059794    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006224.2-424s1c1
Sequence:CCGGCAGAGCAAAGTACCCACGTTTCTCGAGAAACGTGGGTACTTTGCTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006224
VALIDATED
PITPNA MISSION shRNA shRNA Plasmid DNA
phosphatidylinositol transfer protein, alpha
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000299703    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_006224.3-790s21c1
Sequence:CCGGGCAAGAGCTTGTAAACCAGAACTCGAGTTCTGGTTTACAAGCTCTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000299704    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_006224.3-290s21c1
Sequence:CCGGCCTGTGTCTGTAGATGAGTATCTCGAGATACTCATCTACAGACACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000299702    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_006224.3-871s21c1
Sequence:CCGGGCAGAACAAAGTGGAGAACTTCTCGAGAAGTTCTCCACTTTGTTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000299705    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006224.3-449s21c1
Sequence:CCGGCAGAGCAAAGTACCCACGTTTCTCGAGAAACGTGGGTACTTTGCTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059795    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006224.2-846s1c1
Sequence:CCGGGCAGAACAAAGTGGAGAACTTCTCGAGAAGTTCTCCACTTTGTTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059797    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_006224.2-765s1c1
Sequence:CCGGGCAAGAGCTTGTAAACCAGAACTCGAGTTCTGGTTTACAAGCTCTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006224.2-265s1c1
Sequence:CCGGCCTGTGTCTGTAGATGAGTATCTCGAGATACTCATCTACAGACACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059793    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006224.2-912s1c1
Sequence:CCGGGCTGTTCTGTTGGCTCGATAACTCGAGTTATCGAGCCAACAGAACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000310486    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_006224.3-937s21c1
Sequence:CCGGGCTGTTCTGTTGGCTCGATAACTCGAGTTATCGAGCCAACAGAACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059794    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006224.2-424s1c1
Sequence:CCGGCAGAGCAAAGTACCCACGTTTCTCGAGAAACGTGGGTACTTTGCTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006224
VALIDATED
PITPNA MISSION shRNA Lentiviral Transduction Particles
phosphatidylinositol transfer protein, alpha
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000299703    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_006224.3-790s21c1
Sequence:CCGGGCAAGAGCTTGTAAACCAGAACTCGAGTTCTGGTTTACAAGCTCTTGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000299704    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_006224.3-290s21c1
Sequence:CCGGCCTGTGTCTGTAGATGAGTATCTCGAGATACTCATCTACAGACACAGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000299702    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_006224.3-871s21c1
Sequence:CCGGGCAGAACAAAGTGGAGAACTTCTCGAGAAGTTCTCCACTTTGTTCTGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000299705    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006224.3-449s21c1
Sequence:CCGGCAGAGCAAAGTACCCACGTTTCTCGAGAAACGTGGGTACTTTGCTCTGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000059795    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006224.2-846s1c1
Sequence:CCGGGCAGAACAAAGTGGAGAACTTCTCGAGAAGTTCTCCACTTTGTTCTGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000059797    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_006224.2-765s1c1
Sequence:CCGGGCAAGAGCTTGTAAACCAGAACTCGAGTTCTGGTTTACAAGCTCTTGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000059796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006224.2-265s1c1
Sequence:CCGGCCTGTGTCTGTAGATGAGTATCTCGAGATACTCATCTACAGACACAGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000059793    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006224.2-912s1c1
Sequence:CCGGGCTGTTCTGTTGGCTCGATAACTCGAGTTATCGAGCCAACAGAACAGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000310486    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_006224.3-937s21c1
Sequence:CCGGGCTGTTCTGTTGGCTCGATAACTCGAGTTATCGAGCCAACAGAACAGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000059794    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006224.2-424s1c1
Sequence:CCGGCAGAGCAAAGTACCCACGTTTCTCGAGAAACGTGGGTACTTTGCTCTGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???