EMAIL THIS PAGE TO A FRIEND

PITPNM1

phosphatidylinositol transfer protein, membrane-associated 1

46 Gene Product Result for
Synonyms: DRES9 NIR2 PITPNM RDGB RDGB1 RDGBA RDGBA1 Rd9
UniProtKB ID: O00562, A6NME4, Q6T7X3, Q8TBN3, Q9BZ73
Gene ID:
Human(9600) Summary: PITPNM1 belongs to a family of membrane-associated phosphatidylinositol transfer domain-containing proteins that share homology with the Drosophila retinal degeneration B (rdgB) protein (Ocaka et al., 2005 [PubMed 15627748]
Mouse(18739) phosphatidylinositol transfer protein, membrane-associated 1
Rat(361694) phosphatidylinositol transfer protein, membrane-associated 1
domestic guinea pig(100724186) phosphatidylinositol transfer protein, membrane-associated 1
naked mole-rat(101699468) phosphatidylinositol transfer protein, membrane-associated 1
cow(533859) phosphatidylinositol transfer protein, membrane-associated 1
sheep(101110890) phosphatidylinositol transfer protein, membrane-associated 1
chicken(769912) phosphatidylinositol transfer protein, membrane-associated 1
domestic cat(101081927) phosphatidylinositol transfer protein, membrane-associated 1
dog(610462) phosphatidylinositol transfer protein, membrane-associated 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008851 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008851 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008851 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004910 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004910 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004910 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU067681 MISSION® esiRNA esiRNA human PITPNM1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004910 Rosetta Predictions human pricing
NM_001008369 Rosetta Predictions rat pricing
NM_008851 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004910 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00056224 predicted 665
2 SASI_Hs01_00056225 predicted 3557
3 SASI_Hs01_00056226 predicted 2917
4 SASI_Hs01_00056227 predicted 512
5 SASI_Hs02_00338567 predicted 900
6 SASI_Hs01_00056229 predicted 3532
7 SASI_Hs01_00056230 predicted 751
8 SASI_Hs01_00056231 predicted 2980
9 SASI_Hs01_00056232 predicted 198
10 SASI_Hs02_00338568 predicted 507
11 SASI_Hs01_00056228 predicted 3037
12 SASI_Hs01_00056233 predicted 3095
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008369 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00037066 predicted 502
2 SASI_Rn01_00037067 predicted 586
3 SASI_Rn01_00037068 predicted 1379
4 SASI_Rn01_00037069 predicted 2908
5 SASI_Rn01_00037071 predicted 447
6 SASI_Rn01_00037072 predicted 439
7 SASI_Rn01_00037073 predicted 756
8 SASI_Rn01_00037075 predicted 3607
9 SASI_Rn02_00199139 predicted 3555
10 SASI_Rn02_00199140 predicted 750
11 SASI_Rn01_00037070 predicted 1568
12 SASI_Rn01_00037074 predicted 517
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008851 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00314791 predicted 877
2 SASI_Mm01_00041386 predicted 3456
3 SASI_Mm01_00041387 predicted 3917
4 SASI_Mm01_00041388 predicted 3289
5 SASI_Mm01_00041389 predicted 3382
6 SASI_Mm01_00041390 predicted 3405
7 SASI_Mm01_00041391 predicted 3360
8 SASI_Mm02_00314792 predicted 3900
9 SASI_Mm01_00041392 predicted 1615
10 SASI_Mm01_00041393 predicted 1128
11 SASI_Mm01_00041384 predicted 3734
12 SASI_Mm01_00041385 predicted 824
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008851
PITPNM1 MISSION shRNA Bacterial Glycerol Stock
phosphatidylinositol transfer protein, membrane-associated 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000100730    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008851.1-4303s1c1
Sequence:CCGGCTTGGCTGCAACTGGGTTATTCTCGAGAATAACCCAGTTGCAGCCAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100733    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008851.1-625s1c1
Sequence:CCGGCAGCTCTACATGATCCAGAAACTCGAGTTTCTGGATCATGTAGAGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100734    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008851.1-3069s1c1
Sequence:CCGGGCGGATCGACTATTCACTGTACTCGAGTACAGTGAATAGTCGATCCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008851.1-3737s1c1
Sequence:CCGGGCTACTTGATTGTGTATGTAACTCGAGTTACATACACAATCAAGTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332135    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008851.3-2888s21c1
Sequence:CCGGGCAAACCCATTCGAGTCTCTTCTCGAGAAGAGACTCGAATGGGTTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100732    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008851.1-2889s1c1
Sequence:CCGGGCAAACCCATTCGAGTCTCTTCTCGAGAAGAGACTCGAATGGGTTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332133    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008851.3-3068s21c1
Sequence:CCGGGCGGATCGACTATTCACTGTACTCGAGTACAGTGAATAGTCGATCCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332134    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008851.3-4302s21c1
Sequence:CCGGCTTGGCTGCAACTGGGTTATTCTCGAGAATAACCCAGTTGCAGCCAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332136    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008851.3-624s21c1
Sequence:CCGGCAGCTCTACATGATCCAGAAACTCGAGTTTCTGGATCATGTAGAGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008851
PITPNM1 MISSION shRNA shRNA Plasmid DNA
phosphatidylinositol transfer protein, membrane-associated 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000100730    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008851.1-4303s1c1
Sequence:CCGGCTTGGCTGCAACTGGGTTATTCTCGAGAATAACCCAGTTGCAGCCAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100733    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008851.1-625s1c1
Sequence:CCGGCAGCTCTACATGATCCAGAAACTCGAGTTTCTGGATCATGTAGAGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100734    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008851.1-3069s1c1
Sequence:CCGGGCGGATCGACTATTCACTGTACTCGAGTACAGTGAATAGTCGATCCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008851.1-3737s1c1
Sequence:CCGGGCTACTTGATTGTGTATGTAACTCGAGTTACATACACAATCAAGTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000332135    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008851.3-2888s21c1
Sequence:CCGGGCAAACCCATTCGAGTCTCTTCTCGAGAAGAGACTCGAATGGGTTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100732    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008851.1-2889s1c1
Sequence:CCGGGCAAACCCATTCGAGTCTCTTCTCGAGAAGAGACTCGAATGGGTTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000332133    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008851.3-3068s21c1
Sequence:CCGGGCGGATCGACTATTCACTGTACTCGAGTACAGTGAATAGTCGATCCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000332134    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008851.3-4302s21c1
Sequence:CCGGCTTGGCTGCAACTGGGTTATTCTCGAGAATAACCCAGTTGCAGCCAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000332136    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008851.3-624s21c1
Sequence:CCGGCAGCTCTACATGATCCAGAAACTCGAGTTTCTGGATCATGTAGAGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008851
PITPNM1 MISSION shRNA Lentiviral Transduction Particles
phosphatidylinositol transfer protein, membrane-associated 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000100730    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008851.1-4303s1c1
Sequence:CCGGCTTGGCTGCAACTGGGTTATTCTCGAGAATAACCCAGTTGCAGCCAAGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000100733    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008851.1-625s1c1
Sequence:CCGGCAGCTCTACATGATCCAGAAACTCGAGTTTCTGGATCATGTAGAGCTGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000100734    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008851.1-3069s1c1
Sequence:CCGGGCGGATCGACTATTCACTGTACTCGAGTACAGTGAATAGTCGATCCGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000100731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008851.1-3737s1c1
Sequence:CCGGGCTACTTGATTGTGTATGTAACTCGAGTTACATACACAATCAAGTAGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000332135    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008851.3-2888s21c1
Sequence:CCGGGCAAACCCATTCGAGTCTCTTCTCGAGAAGAGACTCGAATGGGTTTGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000100732    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008851.1-2889s1c1
Sequence:CCGGGCAAACCCATTCGAGTCTCTTCTCGAGAAGAGACTCGAATGGGTTTGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000332133    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008851.3-3068s21c1
Sequence:CCGGGCGGATCGACTATTCACTGTACTCGAGTACAGTGAATAGTCGATCCGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000332134    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008851.3-4302s21c1
Sequence:CCGGCTTGGCTGCAACTGGGTTATTCTCGAGAATAACCCAGTTGCAGCCAAGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000332136    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008851.3-624s21c1
Sequence:CCGGCAGCTCTACATGATCCAGAAACTCGAGTTTCTGGATCATGTAGAGCTGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004910
VALIDATED
PITPNM1 MISSION shRNA Bacterial Glycerol Stock
phosphatidylinositol transfer protein, membrane-associated 1
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000029762    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004910.1-1284s1c1
Sequence:CCGGCAAGGAGATGACCAAGTGGAACTCGAGTTCCACTTGGTCATCTCCTTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000441337    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004910.2-1221s21c1
Sequence:CCGGAGTGGCGCATGCAGAACATTGCTCGAGCAATGTTCTGCATGCGCCACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438037    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004910.2-3398s21c1
Sequence:CCGGTCCGGCTACCTGATCGTGTATCTCGAGATACACGATCAGGTAGCCGGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029760    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_004910.1-754s1c1
Sequence:CCGGGCCTATAAGCTGTGCAAGGTTCTCGAGAACCTTGCACAGCTTATAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029761    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_004910.1-3550s1c1
Sequence:CCGGGCCGGTTATGGGTCTCCCAAACTCGAGTTTGGGAGACCCATAACCGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029763    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_004910.1-3027s1c1
Sequence:CCGGCGTCACGCTCACTGGAGAGAACTCGAGTTCTCTCCAGTGAGCGTGACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004910
VALIDATED
PITPNM1 MISSION shRNA shRNA Plasmid DNA
phosphatidylinositol transfer protein, membrane-associated 1
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000029762    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004910.1-1284s1c1
Sequence:CCGGCAAGGAGATGACCAAGTGGAACTCGAGTTCCACTTGGTCATCTCCTTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000441337    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004910.2-1221s21c1
Sequence:CCGGAGTGGCGCATGCAGAACATTGCTCGAGCAATGTTCTGCATGCGCCACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000438037    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004910.2-3398s21c1
Sequence:CCGGTCCGGCTACCTGATCGTGTATCTCGAGATACACGATCAGGTAGCCGGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029760    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_004910.1-754s1c1
Sequence:CCGGGCCTATAAGCTGTGCAAGGTTCTCGAGAACCTTGCACAGCTTATAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029761    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_004910.1-3550s1c1
Sequence:CCGGGCCGGTTATGGGTCTCCCAAACTCGAGTTTGGGAGACCCATAACCGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029763    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_004910.1-3027s1c1
Sequence:CCGGCGTCACGCTCACTGGAGAGAACTCGAGTTCTCTCCAGTGAGCGTGACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004910
VALIDATED
PITPNM1 MISSION shRNA Lentiviral Transduction Particles
phosphatidylinositol transfer protein, membrane-associated 1
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000029762    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004910.1-1284s1c1
Sequence:CCGGCAAGGAGATGACCAAGTGGAACTCGAGTTCCACTTGGTCATCTCCTTGTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000441337    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004910.2-1221s21c1
Sequence:CCGGAGTGGCGCATGCAGAACATTGCTCGAGCAATGTTCTGCATGCGCCACTTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000438037    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004910.2-3398s21c1
Sequence:CCGGTCCGGCTACCTGATCGTGTATCTCGAGATACACGATCAGGTAGCCGGATTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000029760    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_004910.1-754s1c1
Sequence:CCGGGCCTATAAGCTGTGCAAGGTTCTCGAGAACCTTGCACAGCTTATAGGCTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000029761    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_004910.1-3550s1c1
Sequence:CCGGGCCGGTTATGGGTCTCCCAAACTCGAGTTTGGGAGACCCATAACCGGCTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000029763    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_004910.1-3027s1c1
Sequence:CCGGCGTCACGCTCACTGGAGAGAACTCGAGTTCTCTCCAGTGAGCGTGACGTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???