EMAIL THIS PAGE TO A FRIEND

PITPNM2

phosphatidylinositol transfer protein, membrane-associated 2

151 Gene Product Result for
Synonyms: NIR-3 NIR3 RDGB2 RDGBA2
UniProtKB ID: Q9BZ72, Q9P271
Gene ID:
Human(57605) Summary: PITPNM2 belongs to a family of membrane-associated phosphatidylinositol transfer domain-containing proteins that share homology with the Drosophila retinal degeneration B (rdgB) protein (Ocaka et al., 2005 [PubMed 15627748]
Mouse(19679) phosphatidylinositol transfer protein, membrane-associated 2
Rat(304474) phosphatidylinositol transfer protein, membrane-associated 2
chicken(416830) phosphatidylinositol transfer protein, membrane-associated 2
Horse(100060642) phosphatidylinositol transfer protein, membrane-associated 2
domestic cat(101087613) phosphatidylinositol transfer protein, membrane-associated 2
dog(477454) phosphatidylinositol transfer protein, membrane-associated 2
cow(523999) phosphatidylinositol transfer protein, membrane-associated 2
sheep(101118730) phosphatidylinositol transfer protein, membrane-associated 2
naked mole-rat(101717840) phosphatidylinositol transfer protein, membrane-associated 2
Domestic Rabbit(100338877) phosphatidylinositol transfer protein, membrane-associated 2
domestic guinea pig(100721949) phosphatidylinositol transfer protein, membrane-associated 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011256 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011256 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011256 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_020845 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020845 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020845 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU087361 MISSION® esiRNA esiRNA human PITPNM2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020845 Rosetta Predictions human pricing
NM_001107139 Rosetta Predictions rat pricing
NM_011256 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020845 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00100800 predicted 1461
2 SASI_Hs01_00100801 predicted 3373
3 SASI_Hs01_00100802 predicted 895
4 SASI_Hs01_00100803 predicted 450
5 SASI_Hs01_00100804 predicted 1234
6 SASI_Hs01_00100805 predicted 309
7 SASI_Hs01_00100806 predicted 544
8 SASI_Hs01_00100807 predicted 1724
9 SASI_Hs01_00100808 predicted 549
10 SASI_Hs01_00100809 predicted 3156
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107139 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00225885 predicted 516
2 SASI_Rn02_00225886 predicted 2127
3 SASI_Rn02_00225887 predicted 2498
4 SASI_Rn02_00225888 predicted 1882
5 SASI_Rn02_00225889 predicted 512
6 SASI_Rn02_00225890 predicted 766
7 SASI_Rn02_00225891 predicted 2164
8 SASI_Rn02_00225892 predicted 2752
9 SASI_Rn02_00225893 predicted 2106
10 SASI_Rn02_00225894 predicted 3714
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011256 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00058750 predicted 229
2 SASI_Mm01_00058752 predicted 3720
3 SASI_Mm01_00058753 predicted 3063
4 SASI_Mm01_00058755 predicted 2160
5 SASI_Mm01_00058756 predicted 1149
6 SASI_Mm01_00058757 predicted 613
7 SASI_Mm01_00058758 predicted 2102
8 SASI_Mm01_00058759 predicted 510
9 SASI_Mm02_00320261 predicted 1808
10 SASI_Mm02_00320262 predicted 1175
11 SASI_Mm01_00058751 predicted 657
12 SASI_Mm01_00058754 predicted 1249
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011256
VALIDATED
PITPNM2 MISSION shRNA Bacterial Glycerol Stock
phosphatidylinositol transfer protein, membrane-associated 2
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000348964    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011256.1-3554s21c1
Sequence:CCGGTGCGCCACAAGGCTAACTTTCCTCGAGGAAAGTTAGCCTTGTGGCGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304934    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011256.1-515s21c1
Sequence:CCGGAGAAGTTCTCCATTGACATTGCTCGAGCAATGTCAATGGAGAACTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348217    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011256.2-2747s21c1
Sequence:CCGGGACAGAAGCGGATTGACTATGCTCGAGCATAGTCAATCCGCTTCTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348216    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011256.2-3486s21c1
Sequence:CCGGATGGCTGGCTCAGCACAATTTCTCGAGAAATTGTGCTGAGCCAGCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302753    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011256.1-649s21c1
Sequence:CCGGCCCAGTGAGTATAAGACAGAACTCGAGTTCTGTCTTATACTCACTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100467    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011256.1-3629s1c1
Sequence:CCGGCGAAGGATGTCGCAGTCTATACTCGAGTATAGACTGCGACATCCTTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100465    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011256.1-6365s1c1
Sequence:CCGGGCCTTCTCTTTGATTTCTAAACTCGAGTTTAGAAATCAAAGAGAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100468    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011256.1-1539s1c1
Sequence:CCGGCAATACTATCACCAACGTGTTCTCGAGAACACGTTGGTGATAGTATTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100469    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011256.1-1401s1c1
Sequence:CCGGGCTGAACATCATCGAGGATGACTCGAGTCATCCTCGATGATGTTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100466    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011256.1-649s1c1
Sequence:CCGGCCCAGTGAGTATAAGACAGAACTCGAGTTCTGTCTTATACTCACTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304933    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011256.1-231s21c1
Sequence:CCGGGCCAATGACCGTGGATGAATACTCGAGTATTCATCCACGGTCATTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011256
VALIDATED
PITPNM2 MISSION shRNA shRNA Plasmid DNA
phosphatidylinositol transfer protein, membrane-associated 2
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000348964    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011256.1-3554s21c1
Sequence:CCGGTGCGCCACAAGGCTAACTTTCCTCGAGGAAAGTTAGCCTTGTGGCGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000304934    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011256.1-515s21c1
Sequence:CCGGAGAAGTTCTCCATTGACATTGCTCGAGCAATGTCAATGGAGAACTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000348217    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011256.2-2747s21c1
Sequence:CCGGGACAGAAGCGGATTGACTATGCTCGAGCATAGTCAATCCGCTTCTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000348216    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011256.2-3486s21c1
Sequence:CCGGATGGCTGGCTCAGCACAATTTCTCGAGAAATTGTGCTGAGCCAGCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000302753    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011256.1-649s21c1
Sequence:CCGGCCCAGTGAGTATAAGACAGAACTCGAGTTCTGTCTTATACTCACTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100467    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011256.1-3629s1c1
Sequence:CCGGCGAAGGATGTCGCAGTCTATACTCGAGTATAGACTGCGACATCCTTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100465    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011256.1-6365s1c1
Sequence:CCGGGCCTTCTCTTTGATTTCTAAACTCGAGTTTAGAAATCAAAGAGAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100468    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011256.1-1539s1c1
Sequence:CCGGCAATACTATCACCAACGTGTTCTCGAGAACACGTTGGTGATAGTATTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100469    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011256.1-1401s1c1
Sequence:CCGGGCTGAACATCATCGAGGATGACTCGAGTCATCCTCGATGATGTTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100466    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011256.1-649s1c1
Sequence:CCGGCCCAGTGAGTATAAGACAGAACTCGAGTTCTGTCTTATACTCACTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000304933    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011256.1-231s21c1
Sequence:CCGGGCCAATGACCGTGGATGAATACTCGAGTATTCATCCACGGTCATTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011256
VALIDATED
PITPNM2 MISSION shRNA Lentiviral Transduction Particles
phosphatidylinositol transfer protein, membrane-associated 2
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000348964    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011256.1-3554s21c1
Sequence:CCGGTGCGCCACAAGGCTAACTTTCCTCGAGGAAAGTTAGCCTTGTGGCGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304934    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011256.1-515s21c1
Sequence:CCGGAGAAGTTCTCCATTGACATTGCTCGAGCAATGTCAATGGAGAACTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348217    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011256.2-2747s21c1
Sequence:CCGGGACAGAAGCGGATTGACTATGCTCGAGCATAGTCAATCCGCTTCTGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348216    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011256.2-3486s21c1
Sequence:CCGGATGGCTGGCTCAGCACAATTTCTCGAGAAATTGTGCTGAGCCAGCCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302753    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011256.1-649s21c1
Sequence:CCGGCCCAGTGAGTATAAGACAGAACTCGAGTTCTGTCTTATACTCACTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100467    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011256.1-3629s1c1
Sequence:CCGGCGAAGGATGTCGCAGTCTATACTCGAGTATAGACTGCGACATCCTTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100465    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011256.1-6365s1c1
Sequence:CCGGGCCTTCTCTTTGATTTCTAAACTCGAGTTTAGAAATCAAAGAGAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100468    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011256.1-1539s1c1
Sequence:CCGGCAATACTATCACCAACGTGTTCTCGAGAACACGTTGGTGATAGTATTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100469    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011256.1-1401s1c1
Sequence:CCGGGCTGAACATCATCGAGGATGACTCGAGTCATCCTCGATGATGTTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100466    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011256.1-649s1c1
Sequence:CCGGCCCAGTGAGTATAAGACAGAACTCGAGTTCTGTCTTATACTCACTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304933    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011256.1-231s21c1
Sequence:CCGGGCCAATGACCGTGGATGAATACTCGAGTATTCATCCACGGTCATTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020845
PITPNM2 MISSION shRNA Bacterial Glycerol Stock
phosphatidylinositol transfer protein, membrane-associated 2
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000029765    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020845.1-828s1c1
Sequence:CCGGGCTCATGCTTTCCCGTAAGATCTCGAGATCTTACGGGAAAGCATGAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029768    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020845.1-2226s1c1
Sequence:CCGGCTTTGAGATCACCGACCTCTTCTCGAGAAGAGGTCGGTGATCTCAAAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029764    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020845.1-141s1c1
Sequence:CCGGGCTGTACATGATACAGAAGAACTCGAGTTCTTCTGTATCATGTACAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430226    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020845.2-1354s21c1
Sequence:CCGGCATCATAGAGGACGAGGTTAGCTCGAGCTAACCTCGTCCTCTATGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437987    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020845.2-3198s21c1
Sequence:CCGGTGACGGGCAGGTTCATGTATGCTCGAGCATACATGAACCTGCCCGTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029767    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020845.1-480s1c1
Sequence:CCGGCCAGCTGACAATCGACTTCATCTCGAGATGAAGTCGATTGTCAGCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000439434    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020845.2-1844s21c1
Sequence:CCGGGATGCCCTGTGCTACAGTAACCTCGAGGTTACTGTAGCACAGGGCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029766    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020845.1-2334s1c1
Sequence:CCGGCCAGCAAGTCTACAACCTCTTCTCGAGAAGAGGTTGTAGACTTGCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020845
PITPNM2 MISSION shRNA shRNA Plasmid DNA
phosphatidylinositol transfer protein, membrane-associated 2
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000029765    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020845.1-828s1c1
Sequence:CCGGGCTCATGCTTTCCCGTAAGATCTCGAGATCTTACGGGAAAGCATGAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029768    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020845.1-2226s1c1
Sequence:CCGGCTTTGAGATCACCGACCTCTTCTCGAGAAGAGGTCGGTGATCTCAAAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029764    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020845.1-141s1c1
Sequence:CCGGGCTGTACATGATACAGAAGAACTCGAGTTCTTCTGTATCATGTACAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430226    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020845.2-1354s21c1
Sequence:CCGGCATCATAGAGGACGAGGTTAGCTCGAGCTAACCTCGTCCTCTATGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000437987    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020845.2-3198s21c1
Sequence:CCGGTGACGGGCAGGTTCATGTATGCTCGAGCATACATGAACCTGCCCGTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029767    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020845.1-480s1c1
Sequence:CCGGCCAGCTGACAATCGACTTCATCTCGAGATGAAGTCGATTGTCAGCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000439434    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020845.2-1844s21c1
Sequence:CCGGGATGCCCTGTGCTACAGTAACCTCGAGGTTACTGTAGCACAGGGCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029766    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020845.1-2334s1c1
Sequence:CCGGCCAGCAAGTCTACAACCTCTTCTCGAGAAGAGGTTGTAGACTTGCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020845
PITPNM2 MISSION shRNA Lentiviral Transduction Particles
phosphatidylinositol transfer protein, membrane-associated 2
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000029765    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020845.1-828s1c1
Sequence:CCGGGCTCATGCTTTCCCGTAAGATCTCGAGATCTTACGGGAAAGCATGAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029768    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020845.1-2226s1c1
Sequence:CCGGCTTTGAGATCACCGACCTCTTCTCGAGAAGAGGTCGGTGATCTCAAAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029764    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020845.1-141s1c1
Sequence:CCGGGCTGTACATGATACAGAAGAACTCGAGTTCTTCTGTATCATGTACAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430226    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020845.2-1354s21c1
Sequence:CCGGCATCATAGAGGACGAGGTTAGCTCGAGCTAACCTCGTCCTCTATGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437987    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020845.2-3198s21c1
Sequence:CCGGTGACGGGCAGGTTCATGTATGCTCGAGCATACATGAACCTGCCCGTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029767    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020845.1-480s1c1
Sequence:CCGGCCAGCTGACAATCGACTTCATCTCGAGATGAAGTCGATTGTCAGCTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000439434    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020845.2-1844s21c1
Sequence:CCGGGATGCCCTGTGCTACAGTAACCTCGAGGTTACTGTAGCACAGGGCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029766    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020845.1-2334s1c1
Sequence:CCGGCCAGCAAGTCTACAACCTCTTCTCGAGAAGAGGTTGTAGACTTGCTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)