EMAIL THIS PAGE TO A FRIEND

PITPNM3

PITPNM family member 3

69 Gene Product Result for
Synonyms: ACKR6 CORD5 NIR1 RDGBA3
UniProtKB ID: Q9BZ71, A1A5D0, F8WEW5, Q59GH9, Q9NPQ4
Gene ID:
Human(83394) Summary: This gene encodes a member of a family of membrane-associated phosphatidylinositol transfer domain-containing proteins. The calcium-binding protein has phosphatidylinositol (PI) transfer activity and interacts with the protein tyrosine kinase PTK2B (also known as PYK2). The protein is homologous to a Drosophila protein that is implicated in the visual transduction pathway in flies. Mutations in this gene result in autosomal dominant cone dystrophy. Multiple transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Sep 2009]
Mouse(327958) PITPNM family member 3
Rat(287467) PITPNM family member 3
domestic guinea pig(100727944) PITPNM family member 3
naked mole-rat(101706682) PITPNM family member 3
cow(518986) PITPNM family member 3
sheep(101113510) PITPNM family member 3
chicken(417684) PITPNM family member 3
dog(489445) PITPNM family member 3
Horse(100072757) PITPNM family member 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_031220 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_031220 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_031220 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_354620 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_354620 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_354620 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001024927 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001024927 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001024927 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU210441 MISSION® esiRNA esiRNA targeting mouse Pitpnm3 mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_031220 Rosetta Predictions human pricing
XM_001080102 Rosetta Predictions rat pricing
XM_220629 Rosetta Predictions rat pricing
NM_001024927 Rosetta Predictions mouse pricing
NM_001081641 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031220 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00044327 predicted 317
2 SASI_Hs01_00044328 predicted 1922
3 SASI_Hs01_00044330 predicted 2354
4 SASI_Hs01_00044331 predicted 1867
5 SASI_Hs01_00044332 predicted 2042
6 SASI_Hs01_00044334 predicted 354
7 SASI_Hs01_00044335 predicted 465
8 SASI_Hs02_00358635 predicted 2607
9 SASI_Hs01_00044336 predicted 1782
10 SASI_Hs02_00358636 predicted 1815
11 SASI_Hs01_00044329 predicted 1904
12 SASI_Hs01_00044333 predicted 721
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001080102 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00366598 predicted 2619
2 SASI_Rn02_00366599 predicted 625
3 SASI_Rn02_00366600 predicted 2219
4 SASI_Rn02_00366601 predicted 1386
5 SASI_Rn02_00366602 predicted 415
6 SASI_Rn02_00366603 predicted 374
7 SASI_Rn02_00366604 predicted 1750
8 SASI_Rn02_00366605 predicted 554
9 SASI_Rn02_00366606 predicted 2810
10 SASI_Rn02_00366607 predicted 2502
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_220629 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00379466 predicted 1551
2 SASI_Rn02_00379467 predicted 326
3 SASI_Rn02_00379468 predicted 339
4 SASI_Rn02_00379469 predicted 1785
5 SASI_Rn02_00379470 predicted 624
6 SASI_Rn02_00379471 predicted 1939
7 SASI_Rn02_00379472 predicted 1097
8 SASI_Rn02_00379473 predicted 261
9 SASI_Rn02_00379474 predicted 971
10 SASI_Rn02_00379475 predicted 1452
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024927 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00287746 predicted 2086
2 SASI_Mm01_00020318 predicted 740
3 SASI_Mm02_00287747 predicted 2529
4 SASI_Mm02_00287748 predicted 2189
5 SASI_Mm02_00287749 predicted 734
6 SASI_Mm01_00020320 predicted 2736
7 SASI_Mm01_00020322 predicted 1024
8 SASI_Mm01_00020324 predicted 2336
9 SASI_Mm01_00020325 predicted 2055
10 SASI_Mm02_00287750 predicted 1743
11 SASI_Mm01_00020316 predicted 425
12 SASI_Mm01_00020317 predicted 232
13 SASI_Mm01_00020319 predicted 241
14 SASI_Mm01_00020321 predicted 2180
15 SASI_Mm01_00020323 predicted 559
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081641 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00298750 predicted 2042
2 SASI_Mm02_00298751 predicted 689
3 SASI_Mm02_00298752 predicted 2485
4 SASI_Mm02_00298753 predicted 2139
5 SASI_Mm02_00298754 predicted 679
6 SASI_Mm02_00298755 predicted 2681
7 SASI_Mm02_00298756 predicted 971
8 SASI_Mm02_00298757 predicted 2290
9 SASI_Mm02_00298758 predicted 2013
10 SASI_Mm02_00298759 predicted 1695
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031220
PITPNM3 MISSION shRNA Bacterial Glycerol Stock
PITPNM family member 3
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000029769    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031220.1-2033s1c1
Sequence:CCGGCTGAGGAATGTCACGGCTAATCTCGAGATTAGCCGTGACATTCCTCAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029770    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031220.1-2467s1c1
Sequence:CCGGCTTGGGCTACATGATCCTTTACTCGAGTAAAGGATCATGTAGCCCAAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029772    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031220.1-1321s1c1
Sequence:CCGGCTTCGATGTGTCCGACTTCTTCTCGAGAAGAAGTCGGACACATCGAAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029773    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031220.1-2833s1c1
Sequence:CCGGGAAGAACAACTCGCGCATGATCTCGAGATCATGCGCGAGTTGTTCTTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029771    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031220.1-269s1c1
Sequence:CCGGGAGATGGCTGAAGGGAAGAATCTCGAGATTCTTCCCTTCAGCCATCTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031220
PITPNM3 MISSION shRNA shRNA Plasmid DNA
PITPNM family member 3
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000029769    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031220.1-2033s1c1
Sequence:CCGGCTGAGGAATGTCACGGCTAATCTCGAGATTAGCCGTGACATTCCTCAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029770    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031220.1-2467s1c1
Sequence:CCGGCTTGGGCTACATGATCCTTTACTCGAGTAAAGGATCATGTAGCCCAAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029772    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031220.1-1321s1c1
Sequence:CCGGCTTCGATGTGTCCGACTTCTTCTCGAGAAGAAGTCGGACACATCGAAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029773    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031220.1-2833s1c1
Sequence:CCGGGAAGAACAACTCGCGCATGATCTCGAGATCATGCGCGAGTTGTTCTTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029771    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031220.1-269s1c1
Sequence:CCGGGAGATGGCTGAAGGGAAGAATCTCGAGATTCTTCCCTTCAGCCATCTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031220
PITPNM3 MISSION shRNA Lentiviral Transduction Particles
PITPNM family member 3
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000029769    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031220.1-2033s1c1
Sequence:CCGGCTGAGGAATGTCACGGCTAATCTCGAGATTAGCCGTGACATTCCTCAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029770    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031220.1-2467s1c1
Sequence:CCGGCTTGGGCTACATGATCCTTTACTCGAGTAAAGGATCATGTAGCCCAAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029772    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031220.1-1321s1c1
Sequence:CCGGCTTCGATGTGTCCGACTTCTTCTCGAGAAGAAGTCGGACACATCGAAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029773    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031220.1-2833s1c1
Sequence:CCGGGAAGAACAACTCGCGCATGATCTCGAGATCATGCGCGAGTTGTTCTTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029771    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031220.1-269s1c1
Sequence:CCGGGAGATGGCTGAAGGGAAGAATCTCGAGATTCTTCCCTTCAGCCATCTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_354620
PITPNM3 MISSION shRNA Bacterial Glycerol Stock
PITPNM family member 3
Mouse
3 Products Total
TRC Number Price Set Price (3)? Select
TRCN0000203998    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_354620.1-911s1c1
Sequence:CCGGGAGTTCCTCAAGTCCTCTGATCTCGAGATCAGAGGACTTGAGGAACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000203984    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_354620.1-713s1c1
Sequence:CCGGGAGGCTTTCTTCCTTGGTGTACTCGAGTACACCAAGGAAGAAAGCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000203477    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_354620.1-421s1c1
Sequence:CCGGCCAAGGAAGTATCGAGATTCACTCGAGTGAATCTCGATACTTCCTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_354620
PITPNM3 MISSION shRNA shRNA Plasmid DNA
PITPNM family member 3
Mouse
3 Products Total
TRC Number Vector Price Set Price (3)? Select
TRCN0000203998    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_354620.1-911s1c1
Sequence:CCGGGAGTTCCTCAAGTCCTCTGATCTCGAGATCAGAGGACTTGAGGAACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000203984    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_354620.1-713s1c1
Sequence:CCGGGAGGCTTTCTTCCTTGGTGTACTCGAGTACACCAAGGAAGAAAGCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000203477    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_354620.1-421s1c1
Sequence:CCGGCCAAGGAAGTATCGAGATTCACTCGAGTGAATCTCGATACTTCCTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_354620
PITPNM3 MISSION shRNA Lentiviral Transduction Particles
PITPNM family member 3
Mouse
3 Products Total
TRC Number Volume Titer Vector Price Set Price (3)? Select
TRCN0000203998    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_354620.1-911s1c1
Sequence:CCGGGAGTTCCTCAAGTCCTCTGATCTCGAGATCAGAGGACTTGAGGAACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000203984    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_354620.1-713s1c1
Sequence:CCGGGAGGCTTTCTTCCTTGGTGTACTCGAGTACACCAAGGAAGAAAGCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000203477    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_354620.1-421s1c1
Sequence:CCGGCCAAGGAAGTATCGAGATTCACTCGAGTGAATCTCGATACTTCCTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001024927
PITPNM3 MISSION shRNA Bacterial Glycerol Stock
PITPNM family member 3
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000253553    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001024927.2-3612s21c1
Sequence:CCGGTGATATCCGGGCACCACTTTGCTCGAGCAAAGTGGTGCCCGGATATCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217049    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001024927.2-2728s1c1
Sequence:CCGGCTATGGCTCCACGAAAGATATCTCGAGATATCTTTCGTGGAGCCATAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253555    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024927.2-531s21c1
Sequence:CCGGCCCAAGGAAGTATCGAGATTCCTCGAGGAATCTCGATACTTCCTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253556    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024927.2-1754s21c1
Sequence:CCGGACAGAACGGAGGCTAAGTAAACTCGAGTTTACTTAGCCTCCGTTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253554    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024927.2-1857s21c1
Sequence:CCGGGAACCAAGAGGATTGACTATGCTCGAGCATAGTCAATCCTCTTGGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253557    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024927.2-2121s21c1
Sequence:CCGGACCGTGCCAATGATGTAATTGCTCGAGCAATTACATCATTGGCACGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001024927
PITPNM3 MISSION shRNA shRNA Plasmid DNA
PITPNM family member 3
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000253553    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001024927.2-3612s21c1
Sequence:CCGGTGATATCCGGGCACCACTTTGCTCGAGCAAAGTGGTGCCCGGATATCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217049    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001024927.2-2728s1c1
Sequence:CCGGCTATGGCTCCACGAAAGATATCTCGAGATATCTTTCGTGGAGCCATAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000253555    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024927.2-531s21c1
Sequence:CCGGCCCAAGGAAGTATCGAGATTCCTCGAGGAATCTCGATACTTCCTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000253556    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024927.2-1754s21c1
Sequence:CCGGACAGAACGGAGGCTAAGTAAACTCGAGTTTACTTAGCCTCCGTTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000253554    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024927.2-1857s21c1
Sequence:CCGGGAACCAAGAGGATTGACTATGCTCGAGCATAGTCAATCCTCTTGGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000253557    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024927.2-2121s21c1
Sequence:CCGGACCGTGCCAATGATGTAATTGCTCGAGCAATTACATCATTGGCACGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001024927
PITPNM3 MISSION shRNA Lentiviral Transduction Particles
PITPNM family member 3
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000253553    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001024927.2-3612s21c1
Sequence:CCGGTGATATCCGGGCACCACTTTGCTCGAGCAAAGTGGTGCCCGGATATCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217049    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001024927.2-2728s1c1
Sequence:CCGGCTATGGCTCCACGAAAGATATCTCGAGATATCTTTCGTGGAGCCATAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253555    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024927.2-531s21c1
Sequence:CCGGCCCAAGGAAGTATCGAGATTCCTCGAGGAATCTCGATACTTCCTTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253556    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024927.2-1754s21c1
Sequence:CCGGACAGAACGGAGGCTAAGTAAACTCGAGTTTACTTAGCCTCCGTTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253554    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024927.2-1857s21c1
Sequence:CCGGGAACCAAGAGGATTGACTATGCTCGAGCATAGTCAATCCTCTTGGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253557    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024927.2-2121s21c1
Sequence:CCGGACCGTGCCAATGATGTAATTGCTCGAGCAATTACATCATTGGCACGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)