EMAIL THIS PAGE TO A FRIEND

PITRM1

pitrilysin metallopeptidase 1

72 Gene Product Result for
Synonyms: MP1 PreP
Gene ID:
Mouse(69617) pitrilysin metallepetidase 1
Rat(307081) pitrilysin metallopeptidase 1
Zebrafish(406808) pitrilysin metalloproteinase 1
chicken(420462) pitrilysin metallopeptidase 1
Horse(100070807) pitrilysin metallopeptidase 1
domestic cat(101097323) pitrilysin metallopeptidase 1
dog(478018) pitrilysin metallopeptidase 1
cow(513230) pitrilysin metallopeptidase 1
sheep(101111987) pitrilysin metallopeptidase 1
naked mole-rat(101707974) pitrilysin metallopeptidase 1
Domestic Rabbit(100344768) pitrilysin metallopeptidase 1
domestic guinea pig(100723006) pitrilysin metallopeptidase 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145131 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145131 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145131 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_014889 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014889 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014889 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU011041 MISSION® esiRNA esiRNA targeting human PITRM1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014889 Rosetta Predictions human pricing
NM_001107363 Rosetta Predictions rat pricing
NM_145131 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014889 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00215907 predicted 1775
2 SASI_Hs02_00346514 predicted 1674
3 SASI_Hs01_00215909 predicted 505
4 SASI_Hs02_00346515 predicted 2345
5 SASI_Hs02_00346516 predicted 1712
6 SASI_Hs01_00215911 predicted 1239
7 SASI_Hs01_00215912 predicted 2066
8 SASI_Hs01_00215913 predicted 644
9 SASI_Hs01_00215914 predicted 221
10 SASI_Hs01_00215915 predicted 2947
11 SASI_Hs01_00215908 predicted 625
12 SASI_Hs01_00215910 predicted 815
13 SASI_Hs01_00215916 predicted 1021
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107363 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00228085 predicted 2414
2 SASI_Rn02_00228086 predicted 1263
3 SASI_Rn02_00228087 predicted 1367
4 SASI_Rn02_00228088 predicted 2400
5 SASI_Rn02_00228089 predicted 2430
6 SASI_Rn02_00228090 predicted 2567
7 SASI_Rn02_00228091 predicted 969
8 SASI_Rn02_00228092 predicted 775
9 SASI_Rn02_00228093 predicted 2153
10 SASI_Rn02_00228094 predicted 2467
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145131 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00168579 predicted 2683
2 SASI_Mm01_00168580 predicted 875
3 SASI_Mm01_00168581 predicted 791
4 SASI_Mm01_00168582 predicted 2675
5 SASI_Mm01_00168583 predicted 760
6 SASI_Mm01_00168584 predicted 1928
7 SASI_Mm01_00168585 predicted 983
8 SASI_Mm02_00340518 predicted 1643
9 SASI_Mm01_00168586 predicted 1240
10 SASI_Mm01_00168587 predicted 1407
11 SASI_Mm01_00168588 predicted 2731
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145131
VALIDATED
PITRM1 MISSION shRNA Bacterial Glycerol Stock
pitrilysin metallopeptidase 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000353949    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145131.1-1533s21c1
Sequence:CCGGCCAGACGACAAGTATTATGAACTCGAGTTCATAATACTTGTCGTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324878    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145131.1-435s21c1
Sequence:CCGGGCCAGCGATTACACGATATATCTCGAGATATATCGTGTAATCGCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324874    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145131.1-2673s21c1
Sequence:CCGGGCCCGTCTAATGACAGCTAAACTCGAGTTTAGCTGTCATTAGACGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324790    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145131.1-2316s21c1
Sequence:CCGGCGGATCAAGAAGTATCTACTACTCGAGTAGTAGATACTTCTTGATCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031649    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145131.1-2673s1c1
Sequence:CCGGGCCCGTCTAATGACAGCTAAACTCGAGTTTAGCTGTCATTAGACGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031652    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145131.1-2316s1c1
Sequence:CCGGCGGATCAAGAAGTATCTACTACTCGAGTAGTAGATACTTCTTGATCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031653    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145131.1-500s1c1
Sequence:CCGGCGTGTATTTGGATGCAACTTTCTCGAGAAAGTTGCATCCAAATACACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031651    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145131.1-435s1c1
Sequence:CCGGGCCAGCGATTACACGATATATCTCGAGATATATCGTGTAATCGCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031650    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145131.1-1533s1c1
Sequence:CCGGCCAGACGACAAGTATTATGAACTCGAGTTCATAATACTTGTCGTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145131
VALIDATED
PITRM1 MISSION shRNA shRNA Plasmid DNA
pitrilysin metallopeptidase 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000353949    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145131.1-1533s21c1
Sequence:CCGGCCAGACGACAAGTATTATGAACTCGAGTTCATAATACTTGTCGTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000324878    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145131.1-435s21c1
Sequence:CCGGGCCAGCGATTACACGATATATCTCGAGATATATCGTGTAATCGCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000324874    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145131.1-2673s21c1
Sequence:CCGGGCCCGTCTAATGACAGCTAAACTCGAGTTTAGCTGTCATTAGACGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000324790    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145131.1-2316s21c1
Sequence:CCGGCGGATCAAGAAGTATCTACTACTCGAGTAGTAGATACTTCTTGATCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031649    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145131.1-2673s1c1
Sequence:CCGGGCCCGTCTAATGACAGCTAAACTCGAGTTTAGCTGTCATTAGACGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031652    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145131.1-2316s1c1
Sequence:CCGGCGGATCAAGAAGTATCTACTACTCGAGTAGTAGATACTTCTTGATCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031653    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145131.1-500s1c1
Sequence:CCGGCGTGTATTTGGATGCAACTTTCTCGAGAAAGTTGCATCCAAATACACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031651    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145131.1-435s1c1
Sequence:CCGGGCCAGCGATTACACGATATATCTCGAGATATATCGTGTAATCGCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031650    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145131.1-1533s1c1
Sequence:CCGGCCAGACGACAAGTATTATGAACTCGAGTTCATAATACTTGTCGTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145131
VALIDATED
PITRM1 MISSION shRNA Lentiviral Transduction Particles
pitrilysin metallopeptidase 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000353949    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145131.1-1533s21c1
Sequence:CCGGCCAGACGACAAGTATTATGAACTCGAGTTCATAATACTTGTCGTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324878    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145131.1-435s21c1
Sequence:CCGGGCCAGCGATTACACGATATATCTCGAGATATATCGTGTAATCGCTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324874    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145131.1-2673s21c1
Sequence:CCGGGCCCGTCTAATGACAGCTAAACTCGAGTTTAGCTGTCATTAGACGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324790    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145131.1-2316s21c1
Sequence:CCGGCGGATCAAGAAGTATCTACTACTCGAGTAGTAGATACTTCTTGATCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031649    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145131.1-2673s1c1
Sequence:CCGGGCCCGTCTAATGACAGCTAAACTCGAGTTTAGCTGTCATTAGACGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031652    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145131.1-2316s1c1
Sequence:CCGGCGGATCAAGAAGTATCTACTACTCGAGTAGTAGATACTTCTTGATCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031653    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145131.1-500s1c1
Sequence:CCGGCGTGTATTTGGATGCAACTTTCTCGAGAAAGTTGCATCCAAATACACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031651    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145131.1-435s1c1
Sequence:CCGGGCCAGCGATTACACGATATATCTCGAGATATATCGTGTAATCGCTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031650    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145131.1-1533s1c1
Sequence:CCGGCCAGACGACAAGTATTATGAACTCGAGTTCATAATACTTGTCGTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014889
VALIDATED
PITRM1 MISSION shRNA Bacterial Glycerol Stock
pitrilysin metallopeptidase 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000288804    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014889.2-2698s21c1
Sequence:CCGGGCACGTTTGATGACTGCCAAACTCGAGTTTGGCAGTCATCAAACGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288803    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014889.2-816s21c1
Sequence:CCGGCCCAAGCAATGCTAGGTTCTTCTCGAGAAGAACCTAGCATTGCTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296025    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014889.2-3192s21c1
Sequence:CCGGTACACCTCCGAGCTGAATATGCTCGAGCATATTCAGCTCGGAGGTGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000310116    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014889.2-1042s21c1
Sequence:CCGGCCGGACATCACCGACACATTTCTCGAGAAATGTGTCGGTGATGTCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052238    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014889.2-2698s1c1
Sequence:CCGGGCACGTTTGATGACTGCCAAACTCGAGTTTGGCAGTCATCAAACGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052242    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014889.2-816s1c1
Sequence:CCGGCCCAAGCAATGCTAGGTTCTTCTCGAGAAGAACCTAGCATTGCTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052241    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014889.2-2624s1c1
Sequence:CCGGCGGTGAATTACGTGGGTGAATCTCGAGATTCACCCACGTAATTCACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052239    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014889.2-153s1c1
Sequence:CCGGGCAGTATAAACTAGGAGACAACTCGAGTTGTCTCCTAGTTTATACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052240    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014889.2-1711s1c1
Sequence:CCGGCCAGCGTTGAAAGTTTCCGATCTCGAGATCGGAAACTTTCAACGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014889
VALIDATED
PITRM1 MISSION shRNA shRNA Plasmid DNA
pitrilysin metallopeptidase 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000288804    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014889.2-2698s21c1
Sequence:CCGGGCACGTTTGATGACTGCCAAACTCGAGTTTGGCAGTCATCAAACGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000288803    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014889.2-816s21c1
Sequence:CCGGCCCAAGCAATGCTAGGTTCTTCTCGAGAAGAACCTAGCATTGCTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000296025    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014889.2-3192s21c1
Sequence:CCGGTACACCTCCGAGCTGAATATGCTCGAGCATATTCAGCTCGGAGGTGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000310116    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014889.2-1042s21c1
Sequence:CCGGCCGGACATCACCGACACATTTCTCGAGAAATGTGTCGGTGATGTCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052238    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014889.2-2698s1c1
Sequence:CCGGGCACGTTTGATGACTGCCAAACTCGAGTTTGGCAGTCATCAAACGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052242    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014889.2-816s1c1
Sequence:CCGGCCCAAGCAATGCTAGGTTCTTCTCGAGAAGAACCTAGCATTGCTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052241    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014889.2-2624s1c1
Sequence:CCGGCGGTGAATTACGTGGGTGAATCTCGAGATTCACCCACGTAATTCACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052239    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014889.2-153s1c1
Sequence:CCGGGCAGTATAAACTAGGAGACAACTCGAGTTGTCTCCTAGTTTATACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052240    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014889.2-1711s1c1
Sequence:CCGGCCAGCGTTGAAAGTTTCCGATCTCGAGATCGGAAACTTTCAACGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014889
VALIDATED
PITRM1 MISSION shRNA Lentiviral Transduction Particles
pitrilysin metallopeptidase 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000288804    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014889.2-2698s21c1
Sequence:CCGGGCACGTTTGATGACTGCCAAACTCGAGTTTGGCAGTCATCAAACGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288803    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014889.2-816s21c1
Sequence:CCGGCCCAAGCAATGCTAGGTTCTTCTCGAGAAGAACCTAGCATTGCTTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296025    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014889.2-3192s21c1
Sequence:CCGGTACACCTCCGAGCTGAATATGCTCGAGCATATTCAGCTCGGAGGTGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000310116    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014889.2-1042s21c1
Sequence:CCGGCCGGACATCACCGACACATTTCTCGAGAAATGTGTCGGTGATGTCCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052238    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014889.2-2698s1c1
Sequence:CCGGGCACGTTTGATGACTGCCAAACTCGAGTTTGGCAGTCATCAAACGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052242    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014889.2-816s1c1
Sequence:CCGGCCCAAGCAATGCTAGGTTCTTCTCGAGAAGAACCTAGCATTGCTTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052241    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014889.2-2624s1c1
Sequence:CCGGCGGTGAATTACGTGGGTGAATCTCGAGATTCACCCACGTAATTCACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052239    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014889.2-153s1c1
Sequence:CCGGGCAGTATAAACTAGGAGACAACTCGAGTTGTCTCCTAGTTTATACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052240    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014889.2-1711s1c1
Sequence:CCGGCCAGCGTTGAAAGTTTCCGATCTCGAGATCGGAAACTTTCAACGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)