EMAIL THIS PAGE TO A FRIEND

PITX1

paired-like homeodomain 1

72 Gene Product Result for
Synonyms: BFT CCF LBNBG POTX PTX1
UniProtKB ID: P78337, A8K3M0, D3DQB0, O14677, O60425, Q9BTI5
Gene ID:
Human(5307) Summary: This gene encodes a member of the RIEG/PITX homeobox family, which is in the bicoid class of homeodomain proteins. Members of this family are involved in organ development and left-right asymmetry. This protein acts as a transcriptional regulator involved in basal and hormone-regulated activity of prolactin. [provided by RefSeq, Jul 2008]
Mouse(18740) paired-like homeodomain transcription factor 1
Rat(113983) paired-like homeodomain 1
Zebrafish(678598) paired-like homeodomain transcription factor 1
dog(481513) paired-like homeodomain 1
chicken(374201) paired-like homeodomain 1
domestic guinea pig(100715612) paired-like homeodomain 1
Domestic Rabbit(100009361) paired-like homeodomain 1
cow(508754) paired-like homeodomain 1
sheep(100294533) paired-like homeodomain 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011097 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011097 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011097 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002653 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002653 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002653 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002653 Rosetta Predictions human pricing
NM_053624 Rosetta Predictions rat pricing
NM_011097 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002653 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00084529 predicted 822
2 SASI_Hs01_00084530 predicted 1104
3 SASI_Hs01_00084532 predicted 1039
4 SASI_Hs01_00084534 predicted 862
5 SASI_Hs02_00334195 predicted 1799
6 SASI_Hs01_00084536 predicted 664
7 SASI_Hs01_00084537 predicted 659
8 SASI_Hs02_00334196 predicted 673
9 SASI_Hs01_00084538 predicted 1306
10 SASI_Hs02_00334197 predicted 1197
11 SASI_Hs01_00084531 predicted 1133
12 SASI_Hs01_00084533 predicted 860
13 SASI_Hs01_00084535 predicted 1860
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053624 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00095217 predicted 1701
2 SASI_Rn02_00266330 predicted 997
3 SASI_Rn01_00095218 predicted 629
4 SASI_Rn01_00095220 predicted 910
5 SASI_Rn01_00095221 predicted 1695
6 SASI_Rn01_00095222 predicted 1101
7 SASI_Rn01_00095223 predicted 875
8 SASI_Rn01_00095224 predicted 556
9 SASI_Rn02_00266331 predicted 1161
10 SASI_Rn01_00095225 predicted 433
11 SASI_Rn01_00095219 predicted 1702
12 SASI_Rn01_00095226 predicted 614
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011097 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00136552 predicted 1287
2 SASI_Mm01_00136553 predicted 1883
3 SASI_Mm01_00136554 predicted 953
4 SASI_Mm01_00136555 predicted 488
5 SASI_Mm01_00136556 predicted 1402
6 SASI_Mm01_00136557 predicted 1063
7 SASI_Mm01_00136558 predicted 622
8 SASI_Mm01_00136559 predicted 857
9 SASI_Mm02_00319880 predicted 718
10 SASI_Mm01_00136560 predicted 622
11 SASI_Mm01_00136561 predicted 617
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011097
PITX1 MISSION shRNA Bacterial Glycerol Stock
paired-like homeodomain 1
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000054653    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011097.1-1109s1c1
Sequence:CCGGGCTCTCCTCTCAATCCATGTTCTCGAGAACATGGATTGAGAGGAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054654    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011097.1-1070s1c1
Sequence:CCGGGTCTACCAAGAGCTTTACCTTCTCGAGAAGGTAAAGCTCTTGGTAGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054657    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011097.1-833s1c1
Sequence:CCGGCATGAGCATGAGAGAGGAGATCTCGAGATCTCCTCTCTCATGCTCATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054656    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011097.1-1406s1c1
Sequence:CCGGGCTCAACGCTTGCCAGTACAACTCGAGTTGTACTGGCAAGCGTTGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421329    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011097.2-1850s21c1
Sequence:CCGGCCTCAACCCGTGAACTGAATGCTCGAGCATTCAGTTCACGGGTTGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054655    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011097.1-638s1c1
Sequence:CCGGCGACGCTGATCTGCCAGACAACTCGAGTTGTCTGGCAGATCAGCGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419033    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011097.2-1892s21c1
Sequence:CCGGGATCGTTCACCCGGTCAAGAACTCGAGTTCTTGACCGGGTGAACGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011097
PITX1 MISSION shRNA shRNA Plasmid DNA
paired-like homeodomain 1
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000054653    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011097.1-1109s1c1
Sequence:CCGGGCTCTCCTCTCAATCCATGTTCTCGAGAACATGGATTGAGAGGAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054654    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011097.1-1070s1c1
Sequence:CCGGGTCTACCAAGAGCTTTACCTTCTCGAGAAGGTAAAGCTCTTGGTAGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054657    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011097.1-833s1c1
Sequence:CCGGCATGAGCATGAGAGAGGAGATCTCGAGATCTCCTCTCTCATGCTCATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054656    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011097.1-1406s1c1
Sequence:CCGGGCTCAACGCTTGCCAGTACAACTCGAGTTGTACTGGCAAGCGTTGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421329    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011097.2-1850s21c1
Sequence:CCGGCCTCAACCCGTGAACTGAATGCTCGAGCATTCAGTTCACGGGTTGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054655    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011097.1-638s1c1
Sequence:CCGGCGACGCTGATCTGCCAGACAACTCGAGTTGTCTGGCAGATCAGCGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419033    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011097.2-1892s21c1
Sequence:CCGGGATCGTTCACCCGGTCAAGAACTCGAGTTCTTGACCGGGTGAACGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011097
PITX1 MISSION shRNA Lentiviral Transduction Particles
paired-like homeodomain 1
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000054653    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011097.1-1109s1c1
Sequence:CCGGGCTCTCCTCTCAATCCATGTTCTCGAGAACATGGATTGAGAGGAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054654    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011097.1-1070s1c1
Sequence:CCGGGTCTACCAAGAGCTTTACCTTCTCGAGAAGGTAAAGCTCTTGGTAGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054657    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011097.1-833s1c1
Sequence:CCGGCATGAGCATGAGAGAGGAGATCTCGAGATCTCCTCTCTCATGCTCATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054656    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011097.1-1406s1c1
Sequence:CCGGGCTCAACGCTTGCCAGTACAACTCGAGTTGTACTGGCAAGCGTTGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421329    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011097.2-1850s21c1
Sequence:CCGGCCTCAACCCGTGAACTGAATGCTCGAGCATTCAGTTCACGGGTTGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054655    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011097.1-638s1c1
Sequence:CCGGCGACGCTGATCTGCCAGACAACTCGAGTTGTCTGGCAGATCAGCGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419033    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011097.2-1892s21c1
Sequence:CCGGGATCGTTCACCCGGTCAAGAACTCGAGTTCTTGACCGGGTGAACGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002653
PITX1 MISSION shRNA Bacterial Glycerol Stock
paired-like homeodomain 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000020459    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002653.3-1625s1c1
Sequence:CCGGAGTTGCAATTTCTCTCGGGATCTCGAGATCCCGAGAGAAATTGCAACTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020460    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002653.3-1282s1c1
Sequence:CCGGTCCAAACAGCACTCGTCGTTTCTCGAGAAACGACGAGTGCTGTTTGGATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020462    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002653.3-993s1c1
Sequence:CCGGGCCGCTCTCCACCAAGAGCTTCTCGAGAAGCTCTTGGTGGAGAGCGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002653.3-720s1c1
Sequence:CCGGGCAAGAGCTAGAGGCCACGTTCTCGAGAACGTGGCCTCTAGCTCTTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418245    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002653.4-1804s21c1
Sequence:CCGGGCCTGGACTTGCCTAGGATTTCTCGAGAAATCCTAGGCAAGTCCAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020463    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002653.3-1134s1c1
Sequence:CCGGCTCGGGCCTCAACAACATCAACTCGAGTTGATGTTGTTGAGGCCCGAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425220    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002653.4-667s21c1
Sequence:CCGGCAACGTACGCACTTCACAAGCCTCGAGGCTTGTGAAGTGCGTACGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415860    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002653.4-1313s21c1
Sequence:CCGGTCAACGCGTGCCAGTACAACACTCGAGTGTTGTACTGGCACGCGTTGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002653
PITX1 MISSION shRNA shRNA Plasmid DNA
paired-like homeodomain 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000020459    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002653.3-1625s1c1
Sequence:CCGGAGTTGCAATTTCTCTCGGGATCTCGAGATCCCGAGAGAAATTGCAACTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020460    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002653.3-1282s1c1
Sequence:CCGGTCCAAACAGCACTCGTCGTTTCTCGAGAAACGACGAGTGCTGTTTGGATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020462    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002653.3-993s1c1
Sequence:CCGGGCCGCTCTCCACCAAGAGCTTCTCGAGAAGCTCTTGGTGGAGAGCGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002653.3-720s1c1
Sequence:CCGGGCAAGAGCTAGAGGCCACGTTCTCGAGAACGTGGCCTCTAGCTCTTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418245    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002653.4-1804s21c1
Sequence:CCGGGCCTGGACTTGCCTAGGATTTCTCGAGAAATCCTAGGCAAGTCCAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020463    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002653.3-1134s1c1
Sequence:CCGGCTCGGGCCTCAACAACATCAACTCGAGTTGATGTTGTTGAGGCCCGAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425220    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002653.4-667s21c1
Sequence:CCGGCAACGTACGCACTTCACAAGCCTCGAGGCTTGTGAAGTGCGTACGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415860    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002653.4-1313s21c1
Sequence:CCGGTCAACGCGTGCCAGTACAACACTCGAGTGTTGTACTGGCACGCGTTGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002653
PITX1 MISSION shRNA Lentiviral Transduction Particles
paired-like homeodomain 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000020459    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002653.3-1625s1c1
Sequence:CCGGAGTTGCAATTTCTCTCGGGATCTCGAGATCCCGAGAGAAATTGCAACTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020460    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002653.3-1282s1c1
Sequence:CCGGTCCAAACAGCACTCGTCGTTTCTCGAGAAACGACGAGTGCTGTTTGGATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020462    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002653.3-993s1c1
Sequence:CCGGGCCGCTCTCCACCAAGAGCTTCTCGAGAAGCTCTTGGTGGAGAGCGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002653.3-720s1c1
Sequence:CCGGGCAAGAGCTAGAGGCCACGTTCTCGAGAACGTGGCCTCTAGCTCTTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418245    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002653.4-1804s21c1
Sequence:CCGGGCCTGGACTTGCCTAGGATTTCTCGAGAAATCCTAGGCAAGTCCAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020463    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002653.3-1134s1c1
Sequence:CCGGCTCGGGCCTCAACAACATCAACTCGAGTTGATGTTGTTGAGGCCCGAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425220    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002653.4-667s21c1
Sequence:CCGGCAACGTACGCACTTCACAAGCCTCGAGGCTTGTGAAGTGCGTACGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415860    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002653.4-1313s21c1
Sequence:CCGGTCAACGCGTGCCAGTACAACACTCGAGTGTTGTACTGGCACGCGTTGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)