EMAIL THIS PAGE TO A FRIEND

PITX2

paired-like homeodomain 2

261 Gene Product Result for
Synonyms: ARP1 Brx1 IDG2 IGDS IGDS2 IHG2 IRID2 Otlx2 PTX2 RGS RIEG RIEG1 RS
Gene ID:
Human(5308) Summary: This gene encodes a member of the RIEG/PITX homeobox family, which is in the bicoid class of homeodomain proteins. The encoded protein acts as a transcription factor and regulates procollagen lysyl hydroxylase gene expression. This protein plays a role in the terminal differentiation of somatotroph and lactotroph cell phenotypes, is involved in the development of the eye, tooth and abdominal organs, and acts as a transcriptional regulator involved in basal and hormone-regulated activity of prolactin. Mutations in this gene are associated with Axenfeld-Rieger syndrome, iridogoniodysgenesis syndrome, and sporadic cases of Peters anomaly. A similar protein in other vertebrates is involved in the determination of left-right asymmetry during development. Alternatively spliced transcript variants encoding distinct isoforms have been described. [provided by RefSeq, Jul 2008]
Mouse(18741) paired-like homeodomain transcription factor 2
Rat(54284) paired-like homeodomain 2
cow(506721) paired-like homeodomain 2
sheep(101116988) paired-like homeodomain 2
naked mole-rat(101722303) paired-like homeodomain 2
domestic guinea pig(100715589) paired-like homeodomain 2
Zebrafish(30164) paired-like homeodomain transcription factor 2
Horse(100146441) paired-like homeodomain 2
domestic cat(101081219) paired-like homeodomain 2
chicken(395862) paired-like homeodomain 2
dog(487902) paired-like homeodomain 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000325 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000325 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000325 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011098 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011098 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011098 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU072181 MISSION® esiRNA esiRNA human PITX2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000325 Rosetta Predictions human pricing
NM_153426 Rosetta Predictions human pricing
NM_153427 Rosetta Predictions human pricing
NM_001042505 Rosetta Predictions rat pricing
NM_019334 Rosetta Predictions rat pricing
NM_001042502 Rosetta Predictions mouse pricing
NM_001042504 Rosetta Predictions mouse pricing
NM_011098 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000325 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00117388 predicted 1379
2 SASI_Hs01_00117389 predicted 1791
3 SASI_Hs01_00117390 predicted 1660
4 SASI_Hs01_00117391 predicted 1302
5 SASI_Hs01_00117393 predicted 1835
6 SASI_Hs01_00117394 predicted 1716
7 SASI_Hs01_00117395 predicted 1171
8 SASI_Hs01_00117397 predicted 1297
9 SASI_Hs02_00302336 predicted 1799
10 SASI_Hs02_00302337 predicted 1575
11 SASI_Hs01_00117392 predicted 1757
12 SASI_Hs01_00117396 predicted 1212
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153426 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00218952 predicted 1298
2 SASI_Hs02_00367274 predicted 1712
3 SASI_Hs01_00218953 predicted 1582
4 SASI_Hs01_00218954 predicted 1227
5 SASI_Hs01_00218956 predicted 1761
6 SASI_Hs01_00218957 predicted 1639
7 SASI_Hs01_00218958 predicted 1093
8 SASI_Hs01_00218960 predicted 1215
9 SASI_Hs02_00367275 predicted 1722
10 SASI_Hs01_00218961 predicted 1491
11 SASI_Hs01_00218955 predicted 1688
12 SASI_Hs01_00218959 predicted 1131
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153427 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00148495 predicted 1161
2 SASI_Hs02_00367276 predicted 1571
3 SASI_Hs01_00148496 predicted 1445
4 SASI_Hs01_00148497 predicted 1082
5 SASI_Hs01_00148499 predicted 1624
6 SASI_Hs01_00148500 predicted 1496
7 SASI_Hs01_00148501 predicted 958
8 SASI_Hs01_00148503 predicted 1082
9 SASI_Hs02_00367277 predicted 1583
10 SASI_Hs01_00148504 predicted 1354
11 SASI_Hs01_00148498 predicted 1543
12 SASI_Hs01_00148502 predicted 996
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001042505 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00204920 predicted 1481
2 SASI_Rn02_00204921 predicted 1012
3 SASI_Rn02_00204922 predicted 1181
4 SASI_Rn02_00204923 predicted 1460
5 SASI_Rn02_00204924 predicted 1087
6 SASI_Rn02_00204925 predicted 1748
7 SASI_Rn02_00204926 predicted 1652
8 SASI_Rn02_00204927 predicted 1376
9 SASI_Rn02_00204928 predicted 1081
10 SASI_Rn02_00204929 predicted 1512
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019334 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00262313 predicted 1178
2 SASI_Rn02_00262314 predicted 708
3 SASI_Rn01_00121836 predicted 878
4 SASI_Rn02_00262315 predicted 1157
5 SASI_Rn02_00262316 predicted 789
6 SASI_Rn01_00121838 predicted 1450
7 SASI_Rn01_00121839 predicted 1349
8 SASI_Rn01_00121840 predicted 1077
9 SASI_Rn01_00121841 predicted 779
10 SASI_Rn02_00262317 predicted 1214
11 SASI_Rn01_00121837 predicted 1423
12 SASI_Rn01_00121842 predicted 266
13 SASI_Rn01_00121843 predicted 457
14 SASI_Rn01_00121844 predicted 264
15 SASI_Rn01_00121845 predicted 932
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001042502 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00290475 predicted 1114
2 SASI_Mm02_00290476 predicted 1174
3 SASI_Mm02_00290477 predicted 1931
4 SASI_Mm02_00290478 predicted 1468
5 SASI_Mm02_00290479 predicted 1375
6 SASI_Mm02_00290480 predicted 1989
7 SASI_Mm02_00290481 predicted 1798
8 SASI_Mm02_00290482 predicted 1947
9 SASI_Mm02_00290483 predicted 1307
10 SASI_Mm02_00290484 predicted 1939
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001042504 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00290495 predicted 570
2 SASI_Mm02_00290496 predicted 617
3 SASI_Mm02_00290497 predicted 1383
4 SASI_Mm02_00290498 predicted 920
5 SASI_Mm02_00290499 predicted 823
6 SASI_Mm02_00290500 predicted 1436
7 SASI_Mm02_00290501 predicted 1254
8 SASI_Mm02_00290502 predicted 1397
9 SASI_Mm02_00290503 predicted 748
10 SASI_Mm02_00290504 predicted 1391
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011098 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00319881 predicted 717
2 SASI_Mm02_00319882 predicted 766
3 SASI_Mm02_00319883 predicted 1528
4 SASI_Mm01_00185945 predicted 1066
5 SASI_Mm02_00319884 predicted 974
6 SASI_Mm02_00319885 predicted 1585
7 SASI_Mm02_00319886 predicted 1397
8 SASI_Mm02_00319887 predicted 1549
9 SASI_Mm02_00319888 predicted 894
10 SASI_Mm01_00185946 predicted 1531
11 SASI_Mm01_00185947 predicted 1505
12 SASI_Mm01_00185948 predicted 1242
13 SASI_Mm01_00185949 predicted 1382
14 SASI_Mm01_00185950 predicted 946
15 SASI_Mm01_00185951 predicted 233
16 SASI_Mm01_00185952 predicted 1605
17 SASI_Mm01_00185953 predicted 564
18 SASI_Mm01_00185954 predicted 234
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000325
VALIDATED
PITX2 MISSION shRNA Bacterial Glycerol Stock
paired-like homeodomain 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000235580    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000325.5-1457s21c1
Sequence:CCGGGCCGACTCCTCCGTATGTTTACTCGAGTAAACATACGGAGGAGTCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235581    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000325.5-1162s21c1
Sequence:CCGGACGACATGTACCCAGGCTATTCTCGAGAATAGCCTGGGTACATGTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235583    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000325.5-1102s21c1
Sequence:CCGGAGGCCGAGCTATGCAAGAATGCTCGAGCATTCTTGCATAGCTCGGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235584    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000325.5-1370s21c1
Sequence:CCGGCAGTCTCAACAGCCTGAATAACTCGAGTTATTCAGGCTGTTGAGACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235582    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000325.5-2039s21c1
Sequence:CCGGATGTTATACAGAAGCGATTAGCTCGAGCTAATCGCTTCTGTATAACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020479    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: A3
TRC Version: 1 Clone ID:NM_000325.4-2177s1c1
Sequence:CCGGGATGCAATGATGTTTCTGAAACTCGAGTTTCAGAAACATCATTGCATCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020483    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000325.4-1467s1c1
Sequence:CCGGCGTATGTTTATAGGGACACGTCTCGAGACGTGTCCCTATAAACATACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020482    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000325.4-1246s1c1
Sequence:CCGGCTTCAACTCTATGAACGTCAACTCGAGTTGACGTTCATAGAGTTGAAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020481    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000325.4-1368s1c1
Sequence:CCGGCCAGTCTCAACAGCCTGAATACTCGAGTATTCAGGCTGTTGAGACTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020480    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000325.4-1171s1c1
Sequence:CCGGCCCAGGCTATTCCTACAACAACTCGAGTTGTTGTAGGAATAGCCTGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000325
VALIDATED
PITX2 MISSION shRNA shRNA Plasmid DNA
paired-like homeodomain 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000235580    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000325.5-1457s21c1
Sequence:CCGGGCCGACTCCTCCGTATGTTTACTCGAGTAAACATACGGAGGAGTCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235581    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000325.5-1162s21c1
Sequence:CCGGACGACATGTACCCAGGCTATTCTCGAGAATAGCCTGGGTACATGTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235583    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000325.5-1102s21c1
Sequence:CCGGAGGCCGAGCTATGCAAGAATGCTCGAGCATTCTTGCATAGCTCGGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235584    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000325.5-1370s21c1
Sequence:CCGGCAGTCTCAACAGCCTGAATAACTCGAGTTATTCAGGCTGTTGAGACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235582    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000325.5-2039s21c1
Sequence:CCGGATGTTATACAGAAGCGATTAGCTCGAGCTAATCGCTTCTGTATAACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020479    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: A3
TRC Version: 1 Clone ID:NM_000325.4-2177s1c1
Sequence:CCGGGATGCAATGATGTTTCTGAAACTCGAGTTTCAGAAACATCATTGCATCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020483    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000325.4-1467s1c1
Sequence:CCGGCGTATGTTTATAGGGACACGTCTCGAGACGTGTCCCTATAAACATACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020482    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000325.4-1246s1c1
Sequence:CCGGCTTCAACTCTATGAACGTCAACTCGAGTTGACGTTCATAGAGTTGAAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020481    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000325.4-1368s1c1
Sequence:CCGGCCAGTCTCAACAGCCTGAATACTCGAGTATTCAGGCTGTTGAGACTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020480    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000325.4-1171s1c1
Sequence:CCGGCCCAGGCTATTCCTACAACAACTCGAGTTGTTGTAGGAATAGCCTGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000325
VALIDATED
PITX2 MISSION shRNA Lentiviral Transduction Particles
paired-like homeodomain 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000235580    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000325.5-1457s21c1
Sequence:CCGGGCCGACTCCTCCGTATGTTTACTCGAGTAAACATACGGAGGAGTCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235581    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000325.5-1162s21c1
Sequence:CCGGACGACATGTACCCAGGCTATTCTCGAGAATAGCCTGGGTACATGTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235583    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000325.5-1102s21c1
Sequence:CCGGAGGCCGAGCTATGCAAGAATGCTCGAGCATTCTTGCATAGCTCGGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235584    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000325.5-1370s21c1
Sequence:CCGGCAGTCTCAACAGCCTGAATAACTCGAGTTATTCAGGCTGTTGAGACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235582    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000325.5-2039s21c1
Sequence:CCGGATGTTATACAGAAGCGATTAGCTCGAGCTAATCGCTTCTGTATAACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020479    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: A3
TRC Version: 1 Clone ID:NM_000325.4-2177s1c1
Sequence:CCGGGATGCAATGATGTTTCTGAAACTCGAGTTTCAGAAACATCATTGCATCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020483    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000325.4-1467s1c1
Sequence:CCGGCGTATGTTTATAGGGACACGTCTCGAGACGTGTCCCTATAAACATACGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020482    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000325.4-1246s1c1
Sequence:CCGGCTTCAACTCTATGAACGTCAACTCGAGTTGACGTTCATAGAGTTGAAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020481    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000325.4-1368s1c1
Sequence:CCGGCCAGTCTCAACAGCCTGAATACTCGAGTATTCAGGCTGTTGAGACTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020480    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000325.4-1171s1c1
Sequence:CCGGCCCAGGCTATTCCTACAACAACTCGAGTTGTTGTAGGAATAGCCTGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011098
PITX2 MISSION shRNA Bacterial Glycerol Stock
paired-like homeodomain 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000095420    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011098.2-744s1c1
Sequence:CCGGCCCGGCTATTCGTACAACAATCTCGAGATTGTTGTACGAATAGCCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095419    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011098.2-1340s1c1
Sequence:CCGGCGCCTTTGATTTCAAAGGAATCTCGAGATTCCTTTGAAATCAAAGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095423    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011098.2-292s1c1
Sequence:CCGGCCGTTGAATGTCTCTTCTCCACTCGAGTGGAGAAGAGACATTCAACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095422    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011098.2-294s1c1
Sequence:CCGGGTTGAATGTCTCTTCTCCAAACTCGAGTTTGGAGAAGAGACATTCAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095421    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011098.2-1039s1c1
Sequence:CCGGCGTACGTTTATAGGGACACATCTCGAGATGTGTCCCTATAAACGTACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011098
PITX2 MISSION shRNA shRNA Plasmid DNA
paired-like homeodomain 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000095420    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011098.2-744s1c1
Sequence:CCGGCCCGGCTATTCGTACAACAATCTCGAGATTGTTGTACGAATAGCCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000095419    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011098.2-1340s1c1
Sequence:CCGGCGCCTTTGATTTCAAAGGAATCTCGAGATTCCTTTGAAATCAAAGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000095423    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011098.2-292s1c1
Sequence:CCGGCCGTTGAATGTCTCTTCTCCACTCGAGTGGAGAAGAGACATTCAACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000095422    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011098.2-294s1c1
Sequence:CCGGGTTGAATGTCTCTTCTCCAAACTCGAGTTTGGAGAAGAGACATTCAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000095421    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011098.2-1039s1c1
Sequence:CCGGCGTACGTTTATAGGGACACATCTCGAGATGTGTCCCTATAAACGTACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011098
PITX2 MISSION shRNA Lentiviral Transduction Particles
paired-like homeodomain 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000095420    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011098.2-744s1c1
Sequence:CCGGCCCGGCTATTCGTACAACAATCTCGAGATTGTTGTACGAATAGCCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095419    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011098.2-1340s1c1
Sequence:CCGGCGCCTTTGATTTCAAAGGAATCTCGAGATTCCTTTGAAATCAAAGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095423    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011098.2-292s1c1
Sequence:CCGGCCGTTGAATGTCTCTTCTCCACTCGAGTGGAGAAGAGACATTCAACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095422    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011098.2-294s1c1
Sequence:CCGGGTTGAATGTCTCTTCTCCAAACTCGAGTTTGGAGAAGAGACATTCAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095421    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011098.2-1039s1c1
Sequence:CCGGCGTACGTTTATAGGGACACATCTCGAGATGTGTCCCTATAAACGTACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)