EMAIL THIS PAGE TO A FRIEND

PIWIL2

piwi-like RNA-mediated gene silencing 2

62 Gene Product Result for
Synonyms: CT80 HILI PIWIL1L mili
Gene ID:
Human(55124) Summary: PIWIL2 belongs to the Argonaute family of proteins, which function in development and maintenance of germline stem cells (Sasaki et al., 2003 [PubMed 12906857]
Mouse(57746) piwi-like RNA-mediated gene silencing 2
Rat(306011) piwi-like RNA-mediated gene silencing 2
domestic guinea pig(100729867) piwi-like RNA-mediated gene silencing 2
naked mole-rat(101717643) piwi-like RNA-mediated gene silencing 2
cow(537068) piwi-like 2 (Drosophila)
sheep(100616075) piwi-like 2 (Drosophila)
Zebrafish(572134) piwi-like 2 (Drosophila)
Horse(100053825) piwi-like 2 (Drosophila)
domestic cat(101088406) piwi-like 2 (Drosophila)
dog(486125) piwi-like 2 (Drosophila)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021308 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_021308 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_021308 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_018068 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018068 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018068 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018068 Rosetta Predictions human pricing
NM_001107276 Rosetta Predictions rat pricing
NM_021308 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018068 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00351211 predicted 1291
2 SASI_Hs01_00045469 predicted 2584
3 SASI_Hs01_00045470 predicted 935
4 SASI_Hs01_00045471 predicted 1836
5 SASI_Hs02_00351212 predicted 1648
6 SASI_Hs01_00045472 predicted 2964
7 SASI_Hs01_00045473 predicted 2412
8 SASI_Hs02_00351213 predicted 1259
9 SASI_Hs01_00045474 predicted 818
10 SASI_Hs01_00045477 predicted 997
11 SASI_Hs01_00045475 predicted 2524
12 SASI_Hs01_00045476 predicted 747
13 SASI_Hs01_00045478 predicted 1317
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107276 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00227245 predicted 885
2 SASI_Rn02_00227246 predicted 615
3 SASI_Rn02_00227247 predicted 1330
4 SASI_Rn02_00227248 predicted 1964
5 SASI_Rn02_00227249 predicted 486
6 SASI_Rn02_00227250 predicted 1721
7 SASI_Rn02_00227251 predicted 1485
8 SASI_Rn02_00227252 predicted 2879
9 SASI_Rn02_00227253 predicted 1082
10 SASI_Rn02_00227254 predicted 2832
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021308 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00076711 predicted 890
2 SASI_Mm01_00076712 predicted 2532
3 SASI_Mm01_00076713 predicted 1732
4 SASI_Mm01_00076714 predicted 2649
5 SASI_Mm01_00076715 predicted 1906
6 SASI_Mm01_00076717 predicted 2903
7 SASI_Mm01_00076718 predicted 623
8 SASI_Mm02_00325853 predicted 459
9 SASI_Mm01_00076719 predicted 2935
10 SASI_Mm01_00076720 predicted 1982
11 SASI_Mm01_00076716 predicted 486
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021308
PIWIL2 MISSION shRNA Bacterial Glycerol Stock
piwi-like RNA-mediated gene silencing 2
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000009646    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021308.1-1451s1c1
Sequence:CCGGGCGCTACAACAATCGTACCTACTCGAGTAGGTACGATTGTTGTAGCGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009647    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021308.1-670s1c1
Sequence:CCGGCCAGTAGTATAGGCAGAGGAACTCGAGTTCCTCTGCCTATACTACTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009648    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021308.1-1089s1c1
Sequence:CCGGGCCGAGATCAGTATCAAGATTCTCGAGAATCTTGATACTGATCTCGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011811    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021308.1-3222s1c1
Sequence:CCGGCCATCCTTGTAGAATTAGATTCTCGAGAATCTAATTCTACAAGGATGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011812    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021308.1-2898s1c1
Sequence:CCGGCCTACACACTACATCTGTGTTCTCGAGAACACAGATGTAGTGTGTAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360532    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021308.1-2130s21c1
Sequence:CCGGGACCGAATAGAGACCTATATCCTCGAGGATATAGGTCTCTATTCGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360460    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021308.1-3315s21c1
Sequence:CCGGACTGAAGCAGGAGTATCTTTACTCGAGTAAAGATACTCCTGCTTCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360459    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021308.1-1737s21c1
Sequence:CCGGGACTTGACTCAGCAGATTAACCTCGAGGTTAATCTGCTGAGTCAAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360458    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021308.1-1897s21c1
Sequence:CCGGCAATGGAGAGGATCAACTTAACTCGAGTTAAGTTGATCCTCTCCATTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021308
PIWIL2 MISSION shRNA shRNA Plasmid DNA
piwi-like RNA-mediated gene silencing 2
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000009646    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021308.1-1451s1c1
Sequence:CCGGGCGCTACAACAATCGTACCTACTCGAGTAGGTACGATTGTTGTAGCGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009647    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021308.1-670s1c1
Sequence:CCGGCCAGTAGTATAGGCAGAGGAACTCGAGTTCCTCTGCCTATACTACTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009648    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021308.1-1089s1c1
Sequence:CCGGGCCGAGATCAGTATCAAGATTCTCGAGAATCTTGATACTGATCTCGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011811    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021308.1-3222s1c1
Sequence:CCGGCCATCCTTGTAGAATTAGATTCTCGAGAATCTAATTCTACAAGGATGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011812    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021308.1-2898s1c1
Sequence:CCGGCCTACACACTACATCTGTGTTCTCGAGAACACAGATGTAGTGTGTAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000360532    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021308.1-2130s21c1
Sequence:CCGGGACCGAATAGAGACCTATATCCTCGAGGATATAGGTCTCTATTCGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000360460    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021308.1-3315s21c1
Sequence:CCGGACTGAAGCAGGAGTATCTTTACTCGAGTAAAGATACTCCTGCTTCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000360459    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021308.1-1737s21c1
Sequence:CCGGGACTTGACTCAGCAGATTAACCTCGAGGTTAATCTGCTGAGTCAAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000360458    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021308.1-1897s21c1
Sequence:CCGGCAATGGAGAGGATCAACTTAACTCGAGTTAAGTTGATCCTCTCCATTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021308
PIWIL2 MISSION shRNA Lentiviral Transduction Particles
piwi-like RNA-mediated gene silencing 2
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000009646    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021308.1-1451s1c1
Sequence:CCGGGCGCTACAACAATCGTACCTACTCGAGTAGGTACGATTGTTGTAGCGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009647    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021308.1-670s1c1
Sequence:CCGGCCAGTAGTATAGGCAGAGGAACTCGAGTTCCTCTGCCTATACTACTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009648    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021308.1-1089s1c1
Sequence:CCGGGCCGAGATCAGTATCAAGATTCTCGAGAATCTTGATACTGATCTCGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011811    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021308.1-3222s1c1
Sequence:CCGGCCATCCTTGTAGAATTAGATTCTCGAGAATCTAATTCTACAAGGATGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011812    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021308.1-2898s1c1
Sequence:CCGGCCTACACACTACATCTGTGTTCTCGAGAACACAGATGTAGTGTGTAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360532    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021308.1-2130s21c1
Sequence:CCGGGACCGAATAGAGACCTATATCCTCGAGGATATAGGTCTCTATTCGGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360460    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021308.1-3315s21c1
Sequence:CCGGACTGAAGCAGGAGTATCTTTACTCGAGTAAAGATACTCCTGCTTCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360459    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021308.1-1737s21c1
Sequence:CCGGGACTTGACTCAGCAGATTAACCTCGAGGTTAATCTGCTGAGTCAAGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360458    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021308.1-1897s21c1
Sequence:CCGGCAATGGAGAGGATCAACTTAACTCGAGTTAAGTTGATCCTCTCCATTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018068
PIWIL2 MISSION shRNA Bacterial Glycerol Stock
piwi-like RNA-mediated gene silencing 2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000007883    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018068.2-1368s1c1
Sequence:CCGGCGATATAACAATCGTACCTATCTCGAGATAGGTACGATTGTTATATCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007885    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018068.2-1811s1c1
Sequence:CCGGGCCAATGGAAAGAATTAACTTCTCGAGAAGTTAATTCTTTCCATTGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007884    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018068.2-559s1c1
Sequence:CCGGCGTCTTTATTACCACTGGGAACTCGAGTTCCCAGTGGTAATAAAGACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007882    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018068.2-2583s1c1
Sequence:CCGGGCCAACTATGAGATTCCTCAACTCGAGTTGAGGAATCTCATAGTTGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007881    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018068.2-3145s1c1
Sequence:CCGGCCAACCCTGTAGAATAAGATTCTCGAGAATCTTATTCTACAGGGTTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356472    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018068.3-2846s21c1
Sequence:CCGGTGTGGCATTCCTACGCATTATCTCGAGATAATGCGTAGGAATGCCACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356470    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018068.3-1396s21c1
Sequence:CCGGTATTGTTATCACCCGATATAACTCGAGTTATATCGGGTGATAACAATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356549    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018068.3-587s21c1
Sequence:CCGGGGGAGTTCAGATGCGTCTTTACTCGAGTAAAGACGCATCTGAACTCCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356548    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018068.3-962s21c1
Sequence:CCGGACTGCGTTTGATGGATCTATTCTCGAGAATAGATCCATCAAACGCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018068
PIWIL2 MISSION shRNA shRNA Plasmid DNA
piwi-like RNA-mediated gene silencing 2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000007883    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018068.2-1368s1c1
Sequence:CCGGCGATATAACAATCGTACCTATCTCGAGATAGGTACGATTGTTATATCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007885    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018068.2-1811s1c1
Sequence:CCGGGCCAATGGAAAGAATTAACTTCTCGAGAAGTTAATTCTTTCCATTGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007884    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018068.2-559s1c1
Sequence:CCGGCGTCTTTATTACCACTGGGAACTCGAGTTCCCAGTGGTAATAAAGACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007882    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018068.2-2583s1c1
Sequence:CCGGGCCAACTATGAGATTCCTCAACTCGAGTTGAGGAATCTCATAGTTGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007881    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018068.2-3145s1c1
Sequence:CCGGCCAACCCTGTAGAATAAGATTCTCGAGAATCTTATTCTACAGGGTTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000356472    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018068.3-2846s21c1
Sequence:CCGGTGTGGCATTCCTACGCATTATCTCGAGATAATGCGTAGGAATGCCACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000356470    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018068.3-1396s21c1
Sequence:CCGGTATTGTTATCACCCGATATAACTCGAGTTATATCGGGTGATAACAATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000356549    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018068.3-587s21c1
Sequence:CCGGGGGAGTTCAGATGCGTCTTTACTCGAGTAAAGACGCATCTGAACTCCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000356548    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018068.3-962s21c1
Sequence:CCGGACTGCGTTTGATGGATCTATTCTCGAGAATAGATCCATCAAACGCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018068
PIWIL2 MISSION shRNA Lentiviral Transduction Particles
piwi-like RNA-mediated gene silencing 2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000007883    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018068.2-1368s1c1
Sequence:CCGGCGATATAACAATCGTACCTATCTCGAGATAGGTACGATTGTTATATCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007885    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018068.2-1811s1c1
Sequence:CCGGGCCAATGGAAAGAATTAACTTCTCGAGAAGTTAATTCTTTCCATTGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007884    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018068.2-559s1c1
Sequence:CCGGCGTCTTTATTACCACTGGGAACTCGAGTTCCCAGTGGTAATAAAGACGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007882    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018068.2-2583s1c1
Sequence:CCGGGCCAACTATGAGATTCCTCAACTCGAGTTGAGGAATCTCATAGTTGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007881    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018068.2-3145s1c1
Sequence:CCGGCCAACCCTGTAGAATAAGATTCTCGAGAATCTTATTCTACAGGGTTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356472    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018068.3-2846s21c1
Sequence:CCGGTGTGGCATTCCTACGCATTATCTCGAGATAATGCGTAGGAATGCCACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356470    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018068.3-1396s21c1
Sequence:CCGGTATTGTTATCACCCGATATAACTCGAGTTATATCGGGTGATAACAATATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356549    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018068.3-587s21c1
Sequence:CCGGGGGAGTTCAGATGCGTCTTTACTCGAGTAAAGACGCATCTGAACTCCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356548    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018068.3-962s21c1
Sequence:CCGGACTGCGTTTGATGGATCTATTCTCGAGAATAGATCCATCAAACGCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)