EMAIL THIS PAGE TO A FRIEND

PIWIL3

piwi-like RNA-mediated gene silencing 3

43 Gene Product Result for
Synonyms: HIWI3
UniProtKB ID: Q7Z3Z3
Gene ID:
Human(440822) Summary: This gene encodes a member of the PIWI subfamily of Argonaute family proteins. This subfamily of proteins contains a PAZ domain, found in proteins involved in RNA-mediated gene silencing, and a C-terminal Piwi domain. The encoded protein is thought to function in maintenance of germline cells. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2011]
Horse(100059625) piwi-like 3 (Drosophila)
dog(486307) piwi-like 3 (Drosophila)
cow(615479) piwi-like RNA-mediated gene silencing 3
sheep(101116350) piwi-like 3 (Drosophila)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001008496 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001008496 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001008496 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001008496 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008496 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00230251 predicted 2363
2 SASI_Hs01_00230252 predicted 1193
3 SASI_Hs01_00230253 predicted 1692
4 SASI_Hs02_00305480 predicted 1492
5 SASI_Hs01_00230254 predicted 860
6 SASI_Hs01_00230255 predicted 1167
7 SASI_Hs02_00305481 predicted 1977
8 SASI_Hs01_00230256 predicted 915
9 SASI_Hs01_00230257 predicted 1271
10 SASI_Hs01_00230258 predicted 2785
11 SASI_Hs01_00230259 predicted 738
12 SASI_Hs01_00230260 predicted 1245
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001008496
PIWIL3 MISSION shRNA Bacterial Glycerol Stock
piwi-like RNA-mediated gene silencing 3
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000154096    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008496.1-2893s1c1
Sequence:CCGGCCAGATACAGTACAGCGTTTACTCGAGTAAACGCTGTACTGTATCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152548    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001008496.1-3276s1c1
Sequence:CCGGGCTTGCAGTTTCCCTTTCAAACTCGAGTTTGAAAGGGAAACTGCAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152462    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001008496.1-3194s1c1
Sequence:CCGGCAGGAGAGATTCAGAGTGATACTCGAGTATCACTCTGAATCTCTCCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151560    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008496.1-2562s1c1
Sequence:CCGGGCCACATTCTGTTATTGTGTACTCGAGTACACAATAACAGAATGTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150729    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008496.1-2372s1c1
Sequence:CCGGGCATTGATTGTTTCCACGATACTCGAGTATCGTGGAAACAATCAATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153086    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001008496.1-3317s1c1
Sequence:CCGGGCTGAACGTGACTGAACATTTCTCGAGAAATGTTCAGTCACGTTCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153271    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008496.1-1281s1c1
Sequence:CCGGGCTCCGAATAGAAACTGCTTACTCGAGTAAGCAGTTTCTATTCGGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153144    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008496.1-1168s1c1
Sequence:CCGGGCCATTCAGTTATACCGTCATCTCGAGATGACGGTATAACTGAATGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151634    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008496.1-2168s1c1
Sequence:CCGGCCAATGATGACAAACGTAGATCTCGAGATCTACGTTTGTCATCATTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151260    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008496.1-2894s1c1
Sequence:CCGGCAGATACAGTACAGCGTTTAACTCGAGTTAAACGCTGTACTGTATCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001008496
PIWIL3 MISSION shRNA shRNA Plasmid DNA
piwi-like RNA-mediated gene silencing 3
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000154096    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008496.1-2893s1c1
Sequence:CCGGCCAGATACAGTACAGCGTTTACTCGAGTAAACGCTGTACTGTATCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152548    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001008496.1-3276s1c1
Sequence:CCGGGCTTGCAGTTTCCCTTTCAAACTCGAGTTTGAAAGGGAAACTGCAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152462    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001008496.1-3194s1c1
Sequence:CCGGCAGGAGAGATTCAGAGTGATACTCGAGTATCACTCTGAATCTCTCCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151560    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008496.1-2562s1c1
Sequence:CCGGGCCACATTCTGTTATTGTGTACTCGAGTACACAATAACAGAATGTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150729    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008496.1-2372s1c1
Sequence:CCGGGCATTGATTGTTTCCACGATACTCGAGTATCGTGGAAACAATCAATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153086    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001008496.1-3317s1c1
Sequence:CCGGGCTGAACGTGACTGAACATTTCTCGAGAAATGTTCAGTCACGTTCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153271    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008496.1-1281s1c1
Sequence:CCGGGCTCCGAATAGAAACTGCTTACTCGAGTAAGCAGTTTCTATTCGGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153144    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008496.1-1168s1c1
Sequence:CCGGGCCATTCAGTTATACCGTCATCTCGAGATGACGGTATAACTGAATGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151634    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008496.1-2168s1c1
Sequence:CCGGCCAATGATGACAAACGTAGATCTCGAGATCTACGTTTGTCATCATTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151260    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008496.1-2894s1c1
Sequence:CCGGCAGATACAGTACAGCGTTTAACTCGAGTTAAACGCTGTACTGTATCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001008496
PIWIL3 MISSION shRNA Lentiviral Transduction Particles
piwi-like RNA-mediated gene silencing 3
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000154096    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008496.1-2893s1c1
Sequence:CCGGCCAGATACAGTACAGCGTTTACTCGAGTAAACGCTGTACTGTATCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152548    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001008496.1-3276s1c1
Sequence:CCGGGCTTGCAGTTTCCCTTTCAAACTCGAGTTTGAAAGGGAAACTGCAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152462    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001008496.1-3194s1c1
Sequence:CCGGCAGGAGAGATTCAGAGTGATACTCGAGTATCACTCTGAATCTCTCCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151560    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008496.1-2562s1c1
Sequence:CCGGGCCACATTCTGTTATTGTGTACTCGAGTACACAATAACAGAATGTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150729    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008496.1-2372s1c1
Sequence:CCGGGCATTGATTGTTTCCACGATACTCGAGTATCGTGGAAACAATCAATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153086    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001008496.1-3317s1c1
Sequence:CCGGGCTGAACGTGACTGAACATTTCTCGAGAAATGTTCAGTCACGTTCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153271    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008496.1-1281s1c1
Sequence:CCGGGCTCCGAATAGAAACTGCTTACTCGAGTAAGCAGTTTCTATTCGGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153144    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008496.1-1168s1c1
Sequence:CCGGGCCATTCAGTTATACCGTCATCTCGAGATGACGGTATAACTGAATGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151634    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008496.1-2168s1c1
Sequence:CCGGCCAATGATGACAAACGTAGATCTCGAGATCTACGTTTGTCATCATTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151260    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008496.1-2894s1c1
Sequence:CCGGCAGATACAGTACAGCGTTTAACTCGAGTTAAACGCTGTACTGTATCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)