EMAIL THIS PAGE TO A FRIEND

PIWIL4

piwi-like RNA-mediated gene silencing 4

67 Gene Product Result for
Synonyms: HIWI2 MIWI2
UniProtKB ID: Q7Z3Z4, B4DEG5, Q68CZ4, Q8N8G9, Q8N9V8, Q8NEH2
Gene ID:
Human(143689) Summary: PIWIL4 belongs to the Argonaute family of proteins, which function in development and maintenance of germline stem cells (Sasaki et al., 2003 [PubMed 12906857]
Mouse(330890) piwi-like RNA-mediated gene silencing 4
Rat(689972) piwi-like RNA-mediated gene silencing 4
cow(509545) piwi-like RNA-mediated gene silencing 4
sheep(101103838) piwi-like 4 (Drosophila)
naked mole-rat(101711355) piwi-like RNA-mediated gene silencing 4
domestic guinea pig(100731550) piwi-like RNA-mediated gene silencing 4
dog(485123) piwi-like 4 (Drosophila)
Horse(100067172) piwi-like 4 (Drosophila)
domestic cat(101085918) piwi-like 4 (Drosophila)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152431 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152431 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152431 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_177905 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177905 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177905 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152431 Rosetta Predictions human pricing
XM_001072752 Rosetta Predictions rat pricing
NM_177905 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152431 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00210309 predicted 934
2 SASI_Hs02_00366170 predicted 2522
3 SASI_Hs01_00210310 predicted 1075
4 SASI_Hs02_00366171 predicted 2485
5 SASI_Hs01_00210312 predicted 1412
6 SASI_Hs01_00210313 predicted 2612
7 SASI_Hs01_00210314 predicted 2431
8 SASI_Hs01_00210315 predicted 2729
9 SASI_Hs01_00210317 predicted 1003
10 SASI_Hs01_00210318 predicted 918
11 SASI_Hs01_00210311 predicted 2180
12 SASI_Hs01_00210316 predicted 1939
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001072752 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00340395 predicted 654
2 SASI_Rn02_00340396 predicted 407
3 SASI_Rn02_00340397 predicted 205
4 SASI_Rn02_00340398 predicted 644
5 SASI_Rn02_00340399 predicted 865
6 SASI_Rn02_00340400 predicted 871
7 SASI_Rn02_00340401 predicted 796
8 SASI_Rn02_00340402 predicted 707
9 SASI_Rn02_00340403 predicted 300
10 SASI_Rn02_00340404 predicted 505
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177905 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00045013 predicted 889
2 SASI_Mm01_00045014 predicted 491
3 SASI_Mm01_00045015 predicted 1158
4 SASI_Mm01_00045016 predicted 617
5 SASI_Mm01_00045017 predicted 873
6 SASI_Mm01_00045018 predicted 2162
7 SASI_Mm01_00045019 predicted 1068
8 SASI_Mm01_00045020 predicted 1869
9 SASI_Mm01_00045021 predicted 1412
10 SASI_Mm01_00045022 predicted 962
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152431
VALIDATED
PIWIL4 MISSION shRNA Bacterial Glycerol Stock
piwi-like RNA-mediated gene silencing 4
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000143890    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152431.1-1212s1c1
Sequence:CCGGCCATGCTTGTTAGTCTGTTAACTCGAGTTAACAGACTAACAAGCATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143724    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152431.1-2009s1c1
Sequence:CCGGGTCGGTATTGATGTCTGTAAACTCGAGTTTACAGACATCAATACCGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142660    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152431.1-2429s1c1
Sequence:CCGGGCAACACGTAACGAATGGTATCTCGAGATACCATTCGTTACGTGTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142406    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152431.1-1804s1c1
Sequence:CCGGGCCTTCTAATCAGAAGACCTACTCGAGTAGGTCTTCTGATTAGAAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139945    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_152431.1-1403s1c1
Sequence:CCGGGTGGACAACATCCAGAGGAATCTCGAGATTCCTCTGGATGTTGTCCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140185    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A3
TRC Version: 1 Clone ID:NM_152431.1-300s1c1
Sequence:CCGGGCAGGATCTCAACCAACGATACTCGAGTATCGTTGGTTGAGATCCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141209    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_152431.1-2714s1c1
Sequence:CCGGCATGAACTACTGGCATCACTACTCGAGTAGTGATGCCAGTAGTTCATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141359    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_152431.1-1211s1c1
Sequence:CCGGCCCATGCTTGTTAGTCTGTTACTCGAGTAACAGACTAACAAGCATGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141650    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_152431.1-301s1c1
Sequence:CCGGCAGGATCTCAACCAACGATAACTCGAGTTATCGTTGGTTGAGATCCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141814    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_152431.1-808s1c1
Sequence:CCGGGTACCAAATTGGACGGAACTTCTCGAGAAGTTCCGTCCAATTTGGTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142975    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152431.1-2764s1c1
Sequence:CCGGCTTTGTGCAAATCTGCCATAACTCGAGTTATGGCAGATTTGCACAAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143358    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_152431.1-1739s1c1
Sequence:CCGGGCTGCATTTGTTAGAGCTATACTCGAGTATAGCTCTAACAAATGCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139278    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_152431.1-2538s1c1
Sequence:CCGGCCGACCATATGCAGAGACTTACTCGAGTAAGTCTCTGCATATGGTCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143447    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152431.1-2735s1c1
Sequence:CCGGGATGGACAATCCAAGAAGAAACTCGAGTTTCTTCTTGGATTGTCCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152431
VALIDATED
PIWIL4 MISSION shRNA shRNA Plasmid DNA
piwi-like RNA-mediated gene silencing 4
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000143890    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152431.1-1212s1c1
Sequence:CCGGCCATGCTTGTTAGTCTGTTAACTCGAGTTAACAGACTAACAAGCATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000143724    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152431.1-2009s1c1
Sequence:CCGGGTCGGTATTGATGTCTGTAAACTCGAGTTTACAGACATCAATACCGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142660    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152431.1-2429s1c1
Sequence:CCGGGCAACACGTAACGAATGGTATCTCGAGATACCATTCGTTACGTGTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142406    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152431.1-1804s1c1
Sequence:CCGGGCCTTCTAATCAGAAGACCTACTCGAGTAGGTCTTCTGATTAGAAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139945    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_152431.1-1403s1c1
Sequence:CCGGGTGGACAACATCCAGAGGAATCTCGAGATTCCTCTGGATGTTGTCCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140185    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A3
TRC Version: 1 Clone ID:NM_152431.1-300s1c1
Sequence:CCGGGCAGGATCTCAACCAACGATACTCGAGTATCGTTGGTTGAGATCCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141209    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_152431.1-2714s1c1
Sequence:CCGGCATGAACTACTGGCATCACTACTCGAGTAGTGATGCCAGTAGTTCATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141359    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_152431.1-1211s1c1
Sequence:CCGGCCCATGCTTGTTAGTCTGTTACTCGAGTAACAGACTAACAAGCATGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141650    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_152431.1-301s1c1
Sequence:CCGGCAGGATCTCAACCAACGATAACTCGAGTTATCGTTGGTTGAGATCCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141814    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_152431.1-808s1c1
Sequence:CCGGGTACCAAATTGGACGGAACTTCTCGAGAAGTTCCGTCCAATTTGGTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142975    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152431.1-2764s1c1
Sequence:CCGGCTTTGTGCAAATCTGCCATAACTCGAGTTATGGCAGATTTGCACAAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000143358    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_152431.1-1739s1c1
Sequence:CCGGGCTGCATTTGTTAGAGCTATACTCGAGTATAGCTCTAACAAATGCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139278    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_152431.1-2538s1c1
Sequence:CCGGCCGACCATATGCAGAGACTTACTCGAGTAAGTCTCTGCATATGGTCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000143447    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152431.1-2735s1c1
Sequence:CCGGGATGGACAATCCAAGAAGAAACTCGAGTTTCTTCTTGGATTGTCCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152431
VALIDATED
PIWIL4 MISSION shRNA Lentiviral Transduction Particles
piwi-like RNA-mediated gene silencing 4
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000143890    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152431.1-1212s1c1
Sequence:CCGGCCATGCTTGTTAGTCTGTTAACTCGAGTTAACAGACTAACAAGCATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143724    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152431.1-2009s1c1
Sequence:CCGGGTCGGTATTGATGTCTGTAAACTCGAGTTTACAGACATCAATACCGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142660    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152431.1-2429s1c1
Sequence:CCGGGCAACACGTAACGAATGGTATCTCGAGATACCATTCGTTACGTGTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142406    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152431.1-1804s1c1
Sequence:CCGGGCCTTCTAATCAGAAGACCTACTCGAGTAGGTCTTCTGATTAGAAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139945    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_152431.1-1403s1c1
Sequence:CCGGGTGGACAACATCCAGAGGAATCTCGAGATTCCTCTGGATGTTGTCCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140185    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A3
TRC Version: 1 Clone ID:NM_152431.1-300s1c1
Sequence:CCGGGCAGGATCTCAACCAACGATACTCGAGTATCGTTGGTTGAGATCCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141209    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_152431.1-2714s1c1
Sequence:CCGGCATGAACTACTGGCATCACTACTCGAGTAGTGATGCCAGTAGTTCATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141359    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_152431.1-1211s1c1
Sequence:CCGGCCCATGCTTGTTAGTCTGTTACTCGAGTAACAGACTAACAAGCATGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141650    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_152431.1-301s1c1
Sequence:CCGGCAGGATCTCAACCAACGATAACTCGAGTTATCGTTGGTTGAGATCCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141814    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_152431.1-808s1c1
Sequence:CCGGGTACCAAATTGGACGGAACTTCTCGAGAAGTTCCGTCCAATTTGGTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142975    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152431.1-2764s1c1
Sequence:CCGGCTTTGTGCAAATCTGCCATAACTCGAGTTATGGCAGATTTGCACAAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143358    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_152431.1-1739s1c1
Sequence:CCGGGCTGCATTTGTTAGAGCTATACTCGAGTATAGCTCTAACAAATGCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139278    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_152431.1-2538s1c1
Sequence:CCGGCCGACCATATGCAGAGACTTACTCGAGTAAGTCTCTGCATATGGTCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143447    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152431.1-2735s1c1
Sequence:CCGGGATGGACAATCCAAGAAGAAACTCGAGTTTCTTCTTGGATTGTCCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177905
PIWIL4 MISSION shRNA Bacterial Glycerol Stock
piwi-like RNA-mediated gene silencing 4
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000198921    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177905.3-894s1c1
Sequence:CCGGGCTCCTATTCAATGCTGACGTCTCGAGACGTCAGCATTGAATAGGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197570    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177905.3-2433s1c1
Sequence:CCGGCAACGTTATCTATGATGACAACTCGAGTTGTCATCATAGATAACGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197969    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177905.3-55s1c1
Sequence:CCGGGCTGTTTGTAGTAACTATCTTCTCGAGAAGATAGTTACTACAAACAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177905.3-1650s1c1
Sequence:CCGGGCCTTTGAATAGATGGTTGATCTCGAGATCAACCATCTATTCAAAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176520    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177905.3-1150s1c1
Sequence:CCGGCAGCAATATGATATCACCTTACTCGAGTAAGGTGATATCATATTGCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000368870    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177905.3-2171s21c1
Sequence:CCGGAGAGAACAGCGGCTGATATTGCTCGAGCAATATCAGCCGCTGTTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364222    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177905.3-1024s21c1
Sequence:CCGGCTCGTTGTCCTTACCAGATACCTCGAGGTATCTGGTAAGGACAACGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364223    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177905.3-1151s21c1
Sequence:CCGGAGCAATATGATATCACCTTATCTCGAGATAAGGTGATATCATATTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364224    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177905.3-1055s21c1
Sequence:CCGGCATATCGTATCGATGACATTGCTCGAGCAATGTCATCGATACGATATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177905
PIWIL4 MISSION shRNA shRNA Plasmid DNA
piwi-like RNA-mediated gene silencing 4
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000198921    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177905.3-894s1c1
Sequence:CCGGGCTCCTATTCAATGCTGACGTCTCGAGACGTCAGCATTGAATAGGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000197570    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177905.3-2433s1c1
Sequence:CCGGCAACGTTATCTATGATGACAACTCGAGTTGTCATCATAGATAACGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000197969    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177905.3-55s1c1
Sequence:CCGGGCTGTTTGTAGTAACTATCTTCTCGAGAAGATAGTTACTACAAACAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000176917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177905.3-1650s1c1
Sequence:CCGGGCCTTTGAATAGATGGTTGATCTCGAGATCAACCATCTATTCAAAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000176520    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177905.3-1150s1c1
Sequence:CCGGCAGCAATATGATATCACCTTACTCGAGTAAGGTGATATCATATTGCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000368870    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177905.3-2171s21c1
Sequence:CCGGAGAGAACAGCGGCTGATATTGCTCGAGCAATATCAGCCGCTGTTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000364222    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177905.3-1024s21c1
Sequence:CCGGCTCGTTGTCCTTACCAGATACCTCGAGGTATCTGGTAAGGACAACGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000364223    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177905.3-1151s21c1
Sequence:CCGGAGCAATATGATATCACCTTATCTCGAGATAAGGTGATATCATATTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000364224    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177905.3-1055s21c1
Sequence:CCGGCATATCGTATCGATGACATTGCTCGAGCAATGTCATCGATACGATATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177905
PIWIL4 MISSION shRNA Lentiviral Transduction Particles
piwi-like RNA-mediated gene silencing 4
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000198921    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177905.3-894s1c1
Sequence:CCGGGCTCCTATTCAATGCTGACGTCTCGAGACGTCAGCATTGAATAGGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197570    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177905.3-2433s1c1
Sequence:CCGGCAACGTTATCTATGATGACAACTCGAGTTGTCATCATAGATAACGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197969    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177905.3-55s1c1
Sequence:CCGGGCTGTTTGTAGTAACTATCTTCTCGAGAAGATAGTTACTACAAACAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177905.3-1650s1c1
Sequence:CCGGGCCTTTGAATAGATGGTTGATCTCGAGATCAACCATCTATTCAAAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176520    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177905.3-1150s1c1
Sequence:CCGGCAGCAATATGATATCACCTTACTCGAGTAAGGTGATATCATATTGCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000368870    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177905.3-2171s21c1
Sequence:CCGGAGAGAACAGCGGCTGATATTGCTCGAGCAATATCAGCCGCTGTTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364222    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177905.3-1024s21c1
Sequence:CCGGCTCGTTGTCCTTACCAGATACCTCGAGGTATCTGGTAAGGACAACGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364223    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177905.3-1151s21c1
Sequence:CCGGAGCAATATGATATCACCTTATCTCGAGATAAGGTGATATCATATTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364224    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177905.3-1055s21c1
Sequence:CCGGCATATCGTATCGATGACATTGCTCGAGCAATGTCATCGATACGATATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)