EMAIL THIS PAGE TO A FRIEND

PJA1

praja ring finger 1, E3 ubiquitin protein ligase

121 Gene Product Result for
Synonyms: PRAJA1 RNF70
UniProtKB ID: Q8NG27, A2A322, Q5JUT8, Q5JUT9, Q8NG28, Q9HAC1
Gene ID:
Human(64219) Summary: This gene encodes an enzyme that has E2-dependent E3 ubiquitin-protein ligase activity. This enzyme belongs to a class of ubiquitin ligases that include a RING finger motif, and it can interact with the E2 ubiquitin-conjugating enzyme UbcH5B. This gene is located in an area of chromosome X where several X-linked mental retardation disorders have been associated, and it has also been found as part of a contiguous gene deletion associated with craniofrontonasal syndrome, though a direct link to any disorder has yet to be demonstrated. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2010]
Mouse(18744) praja1, RING-H2 motif containing
cow(786612) praja ring finger 1
sheep(101120806) praja ring finger 1, E3 ubiquitin protein ligase
naked mole-rat(101704357) praja ring finger 1, E3 ubiquitin protein ligase
domestic cat(101083066) praja ring finger 1, E3 ubiquitin protein ligase
Horse(100065473) praja ring finger 1, E3 ubiquitin protein ligase
dog(480949) praja ring finger 1, E3 ubiquitin protein ligase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_022368 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022368 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022368 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008853 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008853 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008853 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001032396 Rosetta Predictions human pricing
NM_022368 Rosetta Predictions human pricing
NM_145119 Rosetta Predictions human pricing
NM_001083110 Rosetta Predictions mouse pricing
NM_008853 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001032396 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00207434 predicted 1445
2 SASI_Hs02_00307951 predicted 1265
3 SASI_Hs01_00207436 predicted 1894
4 SASI_Hs02_00307952 predicted 1263
5 SASI_Hs01_00207437 predicted 1979
6 SASI_Hs01_00207438 predicted 1491
7 SASI_Hs01_00207439 predicted 1699
8 SASI_Hs01_00207440 predicted 1983
9 SASI_Hs01_00207441 predicted 1668
10 SASI_Hs01_00207442 predicted 1436
11 SASI_Hs01_00207435 predicted 1273
12 SASI_Hs01_00207443 predicted 1998
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022368 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00138644 predicted 1275
2 SASI_Hs02_00355668 predicted 1096
3 SASI_Hs01_00138646 predicted 1729
4 SASI_Hs02_00355669 predicted 1093
5 SASI_Hs01_00138647 predicted 1813
6 SASI_Hs01_00138648 predicted 1318
7 SASI_Hs01_00138649 predicted 1534
8 SASI_Hs01_00138650 predicted 1811
9 SASI_Hs01_00138651 predicted 1504
10 SASI_Hs01_00138652 predicted 1258
11 SASI_Hs01_00138645 predicted 1097
12 SASI_Hs01_00138653 predicted 1827
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145119 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00231489 predicted 1772
2 SASI_Hs02_00365006 predicted 1591
3 SASI_Hs01_00231491 predicted 2226
4 SASI_Hs02_00365007 predicted 1598
5 SASI_Hs01_00231492 predicted 2307
6 SASI_Hs01_00231493 predicted 1817
7 SASI_Hs01_00231494 predicted 2028
8 SASI_Hs01_00231495 predicted 2312
9 SASI_Hs01_00231496 predicted 1999
10 SASI_Hs01_00231497 predicted 1758
11 SASI_Hs01_00231490 predicted 1592
12 SASI_Hs01_00231498 predicted 2325
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001083110 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00299454 predicted 1663
2 SASI_Mm02_00299455 predicted 1135
3 SASI_Mm02_00299456 predicted 1589
4 SASI_Mm02_00299457 predicted 1541
5 SASI_Mm02_00299458 predicted 1687
6 SASI_Mm02_00299459 predicted 1447
7 SASI_Mm02_00299460 predicted 1244
8 SASI_Mm02_00299461 predicted 1233
9 SASI_Mm02_00299462 predicted 1394
10 SASI_Mm02_00299463 predicted 1362
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008853 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00113929 predicted 1113
2 SASI_Mm02_00314794 predicted 586
3 SASI_Mm02_00314795 predicted 1049
4 SASI_Mm02_00314796 predicted 992
5 SASI_Mm02_00314797 predicted 1142
6 SASI_Mm02_00314798 predicted 890
7 SASI_Mm02_00314799 predicted 688
8 SASI_Mm02_00314800 predicted 678
9 SASI_Mm01_00113933 predicted 848
10 SASI_Mm02_00314801 predicted 816
11 SASI_Mm01_00113928 predicted 481
12 SASI_Mm01_00113930 predicted 1364
13 SASI_Mm01_00113931 predicted 360
14 SASI_Mm01_00113932 predicted 377
15 SASI_Mm01_00113934 predicted 1003
16 SASI_Mm01_00113935 predicted 1280
17 SASI_Mm01_00113936 predicted 1023
18 SASI_Mm01_00113937 predicted 1007
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022368
VALIDATED
PJA1 MISSION shRNA Bacterial Glycerol Stock
praja ring finger 1, E3 ubiquitin protein ligase
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000350908    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022368.3-1817s21c1
Sequence:CCGGCCAATCAGTCAGTTAGCCTAACTCGAGTTAGGCTAACTGACTGATTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338361    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022368.3-907s21c1
Sequence:CCGGGCTGCTCTGCGTCGGAAATATCTCGAGATATTTCCGACGCAGAGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338302    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022368.3-772s21c1
Sequence:CCGGGCGAGGAGTGACCAAGTGAAACTCGAGTTTCACTTGGTCACTCCTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338359    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022368.3-744s21c1
Sequence:CCGGGCCAAAGTACCCTGAAGACAACTCGAGTTGTCTTCAGGGTACTTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022368.x-451s1c1
Sequence:CCGGGAAGTCCCAATGCACAGATCACTCGAGTGATCTGTGCATTGGGACTTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004592    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_022368.x-712s1c1
Sequence:CCGGGCGAGGAGTGACCAAGTGAAACTCGAGTTTCACTTGGTCACTCCTCGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004593    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_022368.x-684s1c1
Sequence:CCGGGCCAAAGTACCCTGAAGACAACTCGAGTTGTCTTCAGGGTACTTTGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004594    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_022368.x-1757s1c1
Sequence:CCGGCCAATCAGTCAGTTAGCCTAACTCGAGTTAGGCTAACTGACTGATTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010896    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_022368.x-679s1c1
Sequence:CCGGCCCGAGCCAAAGTACCCTGAACTCGAGTTCAGGGTACTTTGGCTCGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022368
VALIDATED
PJA1 MISSION shRNA shRNA Plasmid DNA
praja ring finger 1, E3 ubiquitin protein ligase
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000350908    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022368.3-1817s21c1
Sequence:CCGGCCAATCAGTCAGTTAGCCTAACTCGAGTTAGGCTAACTGACTGATTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000338361    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022368.3-907s21c1
Sequence:CCGGGCTGCTCTGCGTCGGAAATATCTCGAGATATTTCCGACGCAGAGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000338302    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022368.3-772s21c1
Sequence:CCGGGCGAGGAGTGACCAAGTGAAACTCGAGTTTCACTTGGTCACTCCTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000338359    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022368.3-744s21c1
Sequence:CCGGGCCAAAGTACCCTGAAGACAACTCGAGTTGTCTTCAGGGTACTTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000004591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022368.x-451s1c1
Sequence:CCGGGAAGTCCCAATGCACAGATCACTCGAGTGATCTGTGCATTGGGACTTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000004592    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_022368.x-712s1c1
Sequence:CCGGGCGAGGAGTGACCAAGTGAAACTCGAGTTTCACTTGGTCACTCCTCGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000004593    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_022368.x-684s1c1
Sequence:CCGGGCCAAAGTACCCTGAAGACAACTCGAGTTGTCTTCAGGGTACTTTGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000004594    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_022368.x-1757s1c1
Sequence:CCGGCCAATCAGTCAGTTAGCCTAACTCGAGTTAGGCTAACTGACTGATTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010896    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_022368.x-679s1c1
Sequence:CCGGCCCGAGCCAAAGTACCCTGAACTCGAGTTCAGGGTACTTTGGCTCGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022368
VALIDATED
PJA1 MISSION shRNA Lentiviral Transduction Particles
praja ring finger 1, E3 ubiquitin protein ligase
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000350908    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022368.3-1817s21c1
Sequence:CCGGCCAATCAGTCAGTTAGCCTAACTCGAGTTAGGCTAACTGACTGATTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338361    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022368.3-907s21c1
Sequence:CCGGGCTGCTCTGCGTCGGAAATATCTCGAGATATTTCCGACGCAGAGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338302    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022368.3-772s21c1
Sequence:CCGGGCGAGGAGTGACCAAGTGAAACTCGAGTTTCACTTGGTCACTCCTCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338359    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022368.3-744s21c1
Sequence:CCGGGCCAAAGTACCCTGAAGACAACTCGAGTTGTCTTCAGGGTACTTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022368.x-451s1c1
Sequence:CCGGGAAGTCCCAATGCACAGATCACTCGAGTGATCTGTGCATTGGGACTTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004592    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_022368.x-712s1c1
Sequence:CCGGGCGAGGAGTGACCAAGTGAAACTCGAGTTTCACTTGGTCACTCCTCGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004593    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_022368.x-684s1c1
Sequence:CCGGGCCAAAGTACCCTGAAGACAACTCGAGTTGTCTTCAGGGTACTTTGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004594    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_022368.x-1757s1c1
Sequence:CCGGCCAATCAGTCAGTTAGCCTAACTCGAGTTAGGCTAACTGACTGATTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010896    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_022368.x-679s1c1
Sequence:CCGGCCCGAGCCAAAGTACCCTGAACTCGAGTTCAGGGTACTTTGGCTCGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008853
VALIDATED
PJA1 MISSION shRNA Bacterial Glycerol Stock
praja ring finger 1, E3 ubiquitin protein ligase
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000307509    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008853.3-1218s21c1
Sequence:CCGGGCTACCATGCCACCACTATTTCTCGAGAAATAGTGGTGGCATGGTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287778    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008853.3-501s21c1
Sequence:CCGGCGACGATTACTACCGATACTACTCGAGTAGTATCGGTAGTAATCGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287777    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008853.3-1389s21c1
Sequence:CCGGCCCTTGTTCTAAACTTACAATCTCGAGATTGTAAGTTTAGAACAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287776    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008853.3-286s21c1
Sequence:CCGGGCTGTTGAGAGTGAGGATTATCTCGAGATAATCCTCACTCTCAACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295220    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008853.3-770s21c1
Sequence:CCGGTCCCTTGGCTTCGCTACAATGCTCGAGCATTGTAGCGAAGCCAAGGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098560    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008853.2-1578s1c1
Sequence:CCGGCCCTTGTTCTAAACTTACAATCTCGAGATTGTAAGTTTAGAACAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098562    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008853.2-690s1c1
Sequence:CCGGCGACGATTACTACCGATACTACTCGAGTAGTATCGGTAGTAATCGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098564    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008853.2-475s1c1
Sequence:CCGGGCTGTTGAGAGTGAGGATTATCTCGAGATAATCCTCACTCTCAACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098563    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008853.2-913s1c1
Sequence:CCGGCCATCTCTTCAGGAGGAAGAACTCGAGTTCTTCCTCCTGAAGAGATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098561    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008853.2-1347s1c1
Sequence:CCGGCCAGGAAATGTGCTGTCCTATCTCGAGATAGGACAGCACATTTCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008853
VALIDATED
PJA1 MISSION shRNA shRNA Plasmid DNA
praja ring finger 1, E3 ubiquitin protein ligase
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000307509    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008853.3-1218s21c1
Sequence:CCGGGCTACCATGCCACCACTATTTCTCGAGAAATAGTGGTGGCATGGTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000287778    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008853.3-501s21c1
Sequence:CCGGCGACGATTACTACCGATACTACTCGAGTAGTATCGGTAGTAATCGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000287777    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008853.3-1389s21c1
Sequence:CCGGCCCTTGTTCTAAACTTACAATCTCGAGATTGTAAGTTTAGAACAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000287776    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008853.3-286s21c1
Sequence:CCGGGCTGTTGAGAGTGAGGATTATCTCGAGATAATCCTCACTCTCAACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000295220    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008853.3-770s21c1
Sequence:CCGGTCCCTTGGCTTCGCTACAATGCTCGAGCATTGTAGCGAAGCCAAGGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098560    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008853.2-1578s1c1
Sequence:CCGGCCCTTGTTCTAAACTTACAATCTCGAGATTGTAAGTTTAGAACAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098562    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008853.2-690s1c1
Sequence:CCGGCGACGATTACTACCGATACTACTCGAGTAGTATCGGTAGTAATCGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098564    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008853.2-475s1c1
Sequence:CCGGGCTGTTGAGAGTGAGGATTATCTCGAGATAATCCTCACTCTCAACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098563    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008853.2-913s1c1
Sequence:CCGGCCATCTCTTCAGGAGGAAGAACTCGAGTTCTTCCTCCTGAAGAGATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098561    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008853.2-1347s1c1
Sequence:CCGGCCAGGAAATGTGCTGTCCTATCTCGAGATAGGACAGCACATTTCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008853
VALIDATED
PJA1 MISSION shRNA Lentiviral Transduction Particles
praja ring finger 1, E3 ubiquitin protein ligase
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000307509    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008853.3-1218s21c1
Sequence:CCGGGCTACCATGCCACCACTATTTCTCGAGAAATAGTGGTGGCATGGTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287778    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008853.3-501s21c1
Sequence:CCGGCGACGATTACTACCGATACTACTCGAGTAGTATCGGTAGTAATCGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287777    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008853.3-1389s21c1
Sequence:CCGGCCCTTGTTCTAAACTTACAATCTCGAGATTGTAAGTTTAGAACAAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287776    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008853.3-286s21c1
Sequence:CCGGGCTGTTGAGAGTGAGGATTATCTCGAGATAATCCTCACTCTCAACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295220    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008853.3-770s21c1
Sequence:CCGGTCCCTTGGCTTCGCTACAATGCTCGAGCATTGTAGCGAAGCCAAGGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098560    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008853.2-1578s1c1
Sequence:CCGGCCCTTGTTCTAAACTTACAATCTCGAGATTGTAAGTTTAGAACAAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098562    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008853.2-690s1c1
Sequence:CCGGCGACGATTACTACCGATACTACTCGAGTAGTATCGGTAGTAATCGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098564    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008853.2-475s1c1
Sequence:CCGGGCTGTTGAGAGTGAGGATTATCTCGAGATAATCCTCACTCTCAACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098563    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008853.2-913s1c1
Sequence:CCGGCCATCTCTTCAGGAGGAAGAACTCGAGTTCTTCCTCCTGAAGAGATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098561    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008853.2-1347s1c1
Sequence:CCGGCCAGGAAATGTGCTGTCCTATCTCGAGATAGGACAGCACATTTCCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)