EMAIL THIS PAGE TO A FRIEND

PJA2

praja ring finger 2, E3 ubiquitin protein ligase

181 Gene Product Result for
Synonyms: Neurodap1 RNF131
UniProtKB ID: O43164, A8K6U4, D3DSZ5, Q68D49, Q8N1G5
Gene ID:
Mouse(224938) praja 2, RING-H2 motif containing
Rat(192256) praja ring finger 2, E3 ubiquitin protein ligase
Zebrafish(565118) praja ring finger 2
dog(479143) praja ring finger 2, E3 ubiquitin protein ligase
chicken(415612) praja ring finger 2, E3 ubiquitin protein ligase
domestic cat(101086203) praja ring finger 2, E3 ubiquitin protein ligase
Horse(100064609) praja ring finger 2, E3 ubiquitin protein ligase
naked mole-rat(101696460) praja ring finger 2, E3 ubiquitin protein ligase
domestic guinea pig(100714812) praja ring finger 2, E3 ubiquitin protein ligase
cow(511508) praja ring finger 2
sheep(101116312) praja ring finger 2, E3 ubiquitin protein ligase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014819 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014819 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014819 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_144859 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_144859 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_144859 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014819 Rosetta Predictions human pricing
NM_138896 Rosetta Predictions rat pricing
NM_001025309 Rosetta Predictions mouse pricing
NM_144859 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014819 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00346348 predicted 2047
2 SASI_Hs02_00346349 predicted 2121
3 SASI_Hs01_00214978 predicted 812
4 SASI_Hs02_00346350 predicted 1622
5 SASI_Hs02_00346351 predicted 603
6 SASI_Hs01_00214982 predicted 949
7 SASI_Hs02_00346352 predicted 458
8 SASI_Hs01_00214984 predicted 560
9 SASI_Hs01_00214986 predicted 2183
10 SASI_Hs02_00346353 predicted 1870
11 SASI_Hs01_00214977 predicted 994
12 SASI_Hs01_00214979 predicted 2035
13 SASI_Hs01_00214980 predicted 368
14 SASI_Hs01_00214981 predicted 1662
15 SASI_Hs01_00214983 predicted 1769
16 SASI_Hs01_00214985 predicted 800
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138896 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00078699 predicted 380
2 SASI_Rn01_00078700 predicted 614
3 SASI_Rn01_00078701 predicted 663
4 SASI_Rn01_00078703 predicted 1986
5 SASI_Rn01_00078705 predicted 443
6 SASI_Rn02_00268345 predicted 2280
7 SASI_Rn01_00078706 predicted 1036
8 SASI_Rn01_00078707 predicted 890
9 SASI_Rn01_00078708 predicted 760
10 SASI_Rn02_00268346 predicted 222
11 SASI_Rn01_00078702 predicted 722
12 SASI_Rn01_00078704 predicted 1920
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025309 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00088037 predicted 2291
2 SASI_Mm01_00088038 predicted 557
3 SASI_Mm01_00088039 predicted 1232
4 SASI_Mm01_00088040 predicted 639
5 SASI_Mm01_00088041 predicted 570
6 SASI_Mm02_00287827 predicted 363
7 SASI_Mm01_00088043 predicted 601
8 SASI_Mm01_00088044 predicted 2336
9 SASI_Mm01_00088045 predicted 931
10 SASI_Mm02_00287828 predicted 474
11 SASI_Mm01_00088036 predicted 870
12 SASI_Mm01_00088042 predicted 2402
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144859 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00044039 predicted 2102
2 SASI_Mm01_00044040 predicted 562
3 SASI_Mm01_00044041 predicted 1232
4 SASI_Mm01_00044042 predicted 638
5 SASI_Mm01_00044043 predicted 568
6 SASI_Mm02_00340283 predicted 371
7 SASI_Mm01_00044045 predicted 601
8 SASI_Mm01_00044046 predicted 2151
9 SASI_Mm01_00044047 predicted 925
10 SASI_Mm02_00340284 predicted 478
11 SASI_Mm01_00044038 predicted 867
12 SASI_Mm01_00044044 predicted 2210
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014819
VALIDATED
PJA2 MISSION shRNA Bacterial Glycerol Stock
praja ring finger 2, E3 ubiquitin protein ligase
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000004422    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014819.x-386s1c1
Sequence:CCGGCCAGTGAACCTATATTTGAAACTCGAGTTTCAAATATAGGTTCACTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004418    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014819.x-1262s1c1
Sequence:CCGGGAGTTATTACACAAAGGGAAACTCGAGTTTCCCTTTGTGTAATAACTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004420    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014819.x-2158s1c1
Sequence:CCGGGCGGTTATTGAAGCATCTGCACTCGAGTGCAGATGCTTCAATAACCGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004421    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014819.x-2961s1c1
Sequence:CCGGGAGCTGAATTAGATGGCCTTACTCGAGTAAGGCCATCTAATTCAGCTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004419    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014819.x-190s1c1
Sequence:CCGGGCAGGAGGGTATCAGACAATTCTCGAGAATTGTCTGATACCCTCCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350901    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014819.4-1365s21c1
Sequence:CCGGGAGTTATTACACAAAGGGAAACTCGAGTTTCCCTTTGTGTAATAACTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338181    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014819.4-489s21c1
Sequence:CCGGCCAGTGAACCTATATTTGAAACTCGAGTTTCAAATATAGGTTCACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338182    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014819.4-3064s21c1
Sequence:CCGGGAGCTGAATTAGATGGCCTTACTCGAGTAAGGCCATCTAATTCAGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338183    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014819.4-1456s21c1
Sequence:CCGGGAATGGCTGTGGAGATTATTACTCGAGTAATAATCTCCACAGCCATTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014819
VALIDATED
PJA2 MISSION shRNA shRNA Plasmid DNA
praja ring finger 2, E3 ubiquitin protein ligase
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000004422    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014819.x-386s1c1
Sequence:CCGGCCAGTGAACCTATATTTGAAACTCGAGTTTCAAATATAGGTTCACTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000004418    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014819.x-1262s1c1
Sequence:CCGGGAGTTATTACACAAAGGGAAACTCGAGTTTCCCTTTGTGTAATAACTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000004420    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014819.x-2158s1c1
Sequence:CCGGGCGGTTATTGAAGCATCTGCACTCGAGTGCAGATGCTTCAATAACCGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000004421    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014819.x-2961s1c1
Sequence:CCGGGAGCTGAATTAGATGGCCTTACTCGAGTAAGGCCATCTAATTCAGCTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000004419    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014819.x-190s1c1
Sequence:CCGGGCAGGAGGGTATCAGACAATTCTCGAGAATTGTCTGATACCCTCCTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000350901    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014819.4-1365s21c1
Sequence:CCGGGAGTTATTACACAAAGGGAAACTCGAGTTTCCCTTTGTGTAATAACTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000338181    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014819.4-489s21c1
Sequence:CCGGCCAGTGAACCTATATTTGAAACTCGAGTTTCAAATATAGGTTCACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000338182    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014819.4-3064s21c1
Sequence:CCGGGAGCTGAATTAGATGGCCTTACTCGAGTAAGGCCATCTAATTCAGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000338183    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014819.4-1456s21c1
Sequence:CCGGGAATGGCTGTGGAGATTATTACTCGAGTAATAATCTCCACAGCCATTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014819
VALIDATED
PJA2 MISSION shRNA Lentiviral Transduction Particles
praja ring finger 2, E3 ubiquitin protein ligase
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000004422    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014819.x-386s1c1
Sequence:CCGGCCAGTGAACCTATATTTGAAACTCGAGTTTCAAATATAGGTTCACTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004418    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014819.x-1262s1c1
Sequence:CCGGGAGTTATTACACAAAGGGAAACTCGAGTTTCCCTTTGTGTAATAACTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004420    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014819.x-2158s1c1
Sequence:CCGGGCGGTTATTGAAGCATCTGCACTCGAGTGCAGATGCTTCAATAACCGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004421    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014819.x-2961s1c1
Sequence:CCGGGAGCTGAATTAGATGGCCTTACTCGAGTAAGGCCATCTAATTCAGCTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004419    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014819.x-190s1c1
Sequence:CCGGGCAGGAGGGTATCAGACAATTCTCGAGAATTGTCTGATACCCTCCTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350901    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014819.4-1365s21c1
Sequence:CCGGGAGTTATTACACAAAGGGAAACTCGAGTTTCCCTTTGTGTAATAACTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338181    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014819.4-489s21c1
Sequence:CCGGCCAGTGAACCTATATTTGAAACTCGAGTTTCAAATATAGGTTCACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338182    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014819.4-3064s21c1
Sequence:CCGGGAGCTGAATTAGATGGCCTTACTCGAGTAAGGCCATCTAATTCAGCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338183    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014819.4-1456s21c1
Sequence:CCGGGAATGGCTGTGGAGATTATTACTCGAGTAATAATCTCCACAGCCATTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144859
PJA2 MISSION shRNA Bacterial Glycerol Stock
praja ring finger 2, E3 ubiquitin protein ligase
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000041003    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144859.1-767s1c1
Sequence:CCGGCGGTGAAATAAGTGAGGCGTTCTCGAGAACGCCTCACTTATTTCACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144859.1-1734s1c1
Sequence:CCGGGCCAGTAAGGAAAGCATTGATCTCGAGATCAATGCTTTCCTTACTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041007    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144859.1-756s1c1
Sequence:CCGGCCCTCTCTCAACGGTGAAATACTCGAGTATTTCACCGTTGAGAGAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041004    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144859.1-1340s1c1
Sequence:CCGGCGGAGAGTATTACCAACTCTTCTCGAGAAGAGTTGGTAATACTCTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041005    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144859.1-1170s1c1
Sequence:CCGGCCTATAATAAAGTGTGACGATCTCGAGATCGTCACACTTTATTATAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144859
PJA2 MISSION shRNA shRNA Plasmid DNA
praja ring finger 2, E3 ubiquitin protein ligase
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000041003    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144859.1-767s1c1
Sequence:CCGGCGGTGAAATAAGTGAGGCGTTCTCGAGAACGCCTCACTTATTTCACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144859.1-1734s1c1
Sequence:CCGGGCCAGTAAGGAAAGCATTGATCTCGAGATCAATGCTTTCCTTACTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041007    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144859.1-756s1c1
Sequence:CCGGCCCTCTCTCAACGGTGAAATACTCGAGTATTTCACCGTTGAGAGAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041004    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144859.1-1340s1c1
Sequence:CCGGCGGAGAGTATTACCAACTCTTCTCGAGAAGAGTTGGTAATACTCTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041005    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144859.1-1170s1c1
Sequence:CCGGCCTATAATAAAGTGTGACGATCTCGAGATCGTCACACTTTATTATAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144859
PJA2 MISSION shRNA Lentiviral Transduction Particles
praja ring finger 2, E3 ubiquitin protein ligase
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000041003    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144859.1-767s1c1
Sequence:CCGGCGGTGAAATAAGTGAGGCGTTCTCGAGAACGCCTCACTTATTTCACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144859.1-1734s1c1
Sequence:CCGGGCCAGTAAGGAAAGCATTGATCTCGAGATCAATGCTTTCCTTACTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041007    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144859.1-756s1c1
Sequence:CCGGCCCTCTCTCAACGGTGAAATACTCGAGTATTTCACCGTTGAGAGAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041004    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144859.1-1340s1c1
Sequence:CCGGCGGAGAGTATTACCAACTCTTCTCGAGAAGAGTTGGTAATACTCTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041005    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144859.1-1170s1c1
Sequence:CCGGCCTATAATAAAGTGTGACGATCTCGAGATCGTCACACTTTATTATAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)