EMAIL THIS PAGE TO A FRIEND

PKD1L2

polycystic kidney disease 1-like 2

65 Gene Product Result for
Synonyms: PC1L2
Gene ID:
Human(114780) Summary: This gene encodes a member of the polycystin protein family. The encoded protein contains 11 transmembrane domains, a latrophilin/CL-1-like GPCR proteolytic site (GPS) domain, and a polycystin-1, lipoxygenase, alpha-toxin (PLAT) domain. This protein may function as a component of cation channel pores. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2013]
Mouse(76645) polycystic kidney disease 1 like 2
cow(101905746) polycystic kidney disease 1-like 2
sheep(101121034) polycystic kidney disease 1-like 2
Domestic Rabbit(100357827) polycystic kidney disease 1-like 2
naked mole-rat(101715670) polycystic kidney disease 1-like 2
domestic guinea pig(100728753) polycystic kidney disease 1-like 2
chicken(431055) polycystic kidney disease 1-like 2
dog(489696) polycystic kidney disease 1-like 2
Horse(100069843) polycystic kidney disease 1-like 2
domestic cat(101084591) polycystic kidney disease 1-like 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_052892 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_052892 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_052892 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_029686 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029686 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029686 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU052811 MISSION® esiRNA esiRNA targeting mouse Pkd1l2 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001076780 Rosetta Predictions human pricing
NM_052892 Rosetta Predictions human pricing
NM_182740 Rosetta Predictions human pricing
NM_029686 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001076780 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00312024 predicted 717
2 SASI_Hs02_00312025 predicted 2588
3 SASI_Hs02_00312026 predicted 2600
4 SASI_Hs02_00312027 predicted 780
5 SASI_Hs02_00312028 predicted 1662
6 SASI_Hs02_00312029 predicted 2429
7 SASI_Hs02_00312030 predicted 1633
8 SASI_Hs02_00312031 predicted 850
9 SASI_Hs02_00312032 predicted 2011
10 SASI_Hs02_00312033 predicted 1140
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_052892 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00224123 predicted 722
2 SASI_Hs02_00361613 predicted 2589
3 SASI_Hs02_00361614 predicted 2593
4 SASI_Hs02_00361615 predicted 774
5 SASI_Hs01_00224125 predicted 1661
6 SASI_Hs02_00361616 predicted 2421
7 SASI_Hs01_00224128 predicted 1628
8 SASI_Hs02_00361617 predicted 848
9 SASI_Hs02_00361618 predicted 2019
10 SASI_Hs02_00361619 predicted 1137
11 SASI_Hs01_00224124 predicted 4244
12 SASI_Hs01_00224126 predicted 4599
13 SASI_Hs01_00224127 predicted 3675
14 SASI_Hs01_00224129 predicted 2722
15 SASI_Hs01_00224130 predicted 3454
16 SASI_Hs01_00224131 predicted 6449
17 SASI_Hs01_00224132 predicted 6422
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182740 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00138314 predicted 726
2 SASI_Hs01_00138315 predicted 2595
3 SASI_Hs01_00138316 predicted 4244
4 SASI_Hs01_00138317 predicted 1672
5 SASI_Hs01_00138318 predicted 4593
6 SASI_Hs01_00138319 predicted 3667
7 SASI_Hs01_00138320 predicted 1635
8 SASI_Hs01_00138321 predicted 2723
9 SASI_Hs01_00138322 predicted 3451
10 SASI_Hs01_00138323 predicted 1150
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029686 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00180262 predicted 6970
2 SASI_Mm01_00180263 predicted 3657
3 SASI_Mm02_00335719 predicted 3839
4 SASI_Mm01_00180264 predicted 4105
5 SASI_Mm01_00180266 predicted 3787
6 SASI_Mm01_00180267 predicted 233
7 SASI_Mm01_00180268 predicted 2095
8 SASI_Mm02_00335720 predicted 2672
9 SASI_Mm01_00180270 predicted 2235
10 SASI_Mm02_00335721 predicted 712
11 SASI_Mm01_00180261 predicted 6426
12 SASI_Mm01_00180265 predicted 1643
13 SASI_Mm01_00180269 predicted 1004
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_052892
PKD1L2 MISSION shRNA Bacterial Glycerol Stock
polycystic kidney disease 1-like 2
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000432377    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052892.3-2077s21c1
Sequence:CCGGGCTATGTTCAGCTGGTATTTGCTCGAGCAAATACCAGCTGAACATAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427828    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052892.3-6152s21c1
Sequence:CCGGACGGATGCCGTGCACCATATTCTCGAGAATATGGTGCACGGCATCCGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412990    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052892.3-4441s21c1
Sequence:CCGGATGGACCGGAAGTGGTATTTCCTCGAGGAAATACCACTTCCGGTCCATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052892.2-3330s1c1
Sequence:CCGGGCCCGTGGATATAAAGATCATCTCGAGATGATCTTTATATCCACGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077970    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052892.2-682s1c1
Sequence:CCGGGCAGCAGATGAGACCTACTTTCTCGAGAAAGTAGGTCTCATCTGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077969    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052892.2-6938s1c1
Sequence:CCGGGCTTTATGATTGTCATCCTTACTCGAGTAAGGATGACAATCATAAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077972    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052892.2-4816s1c1
Sequence:CCGGCCCATCAACCTCCTGATTGTTCTCGAGAACAATCAGGAGGTTGATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077968    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_052892.2-7467s1c1
Sequence:CCGGGTCATAGCTTTCATGTCCATTCTCGAGAATGGACATGAAAGCTATGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_052892
PKD1L2 MISSION shRNA shRNA Plasmid DNA
polycystic kidney disease 1-like 2
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000432377    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052892.3-2077s21c1
Sequence:CCGGGCTATGTTCAGCTGGTATTTGCTCGAGCAAATACCAGCTGAACATAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427828    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052892.3-6152s21c1
Sequence:CCGGACGGATGCCGTGCACCATATTCTCGAGAATATGGTGCACGGCATCCGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000412990    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052892.3-4441s21c1
Sequence:CCGGATGGACCGGAAGTGGTATTTCCTCGAGGAAATACCACTTCCGGTCCATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052892.2-3330s1c1
Sequence:CCGGGCCCGTGGATATAAAGATCATCTCGAGATGATCTTTATATCCACGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077970    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052892.2-682s1c1
Sequence:CCGGGCAGCAGATGAGACCTACTTTCTCGAGAAAGTAGGTCTCATCTGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077969    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052892.2-6938s1c1
Sequence:CCGGGCTTTATGATTGTCATCCTTACTCGAGTAAGGATGACAATCATAAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077972    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052892.2-4816s1c1
Sequence:CCGGCCCATCAACCTCCTGATTGTTCTCGAGAACAATCAGGAGGTTGATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077968    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_052892.2-7467s1c1
Sequence:CCGGGTCATAGCTTTCATGTCCATTCTCGAGAATGGACATGAAAGCTATGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_052892
PKD1L2 MISSION shRNA Lentiviral Transduction Particles
polycystic kidney disease 1-like 2
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000432377    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052892.3-2077s21c1
Sequence:CCGGGCTATGTTCAGCTGGTATTTGCTCGAGCAAATACCAGCTGAACATAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427828    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052892.3-6152s21c1
Sequence:CCGGACGGATGCCGTGCACCATATTCTCGAGAATATGGTGCACGGCATCCGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412990    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052892.3-4441s21c1
Sequence:CCGGATGGACCGGAAGTGGTATTTCCTCGAGGAAATACCACTTCCGGTCCATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052892.2-3330s1c1
Sequence:CCGGGCCCGTGGATATAAAGATCATCTCGAGATGATCTTTATATCCACGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077970    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052892.2-682s1c1
Sequence:CCGGGCAGCAGATGAGACCTACTTTCTCGAGAAAGTAGGTCTCATCTGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077969    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052892.2-6938s1c1
Sequence:CCGGGCTTTATGATTGTCATCCTTACTCGAGTAAGGATGACAATCATAAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077972    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052892.2-4816s1c1
Sequence:CCGGCCCATCAACCTCCTGATTGTTCTCGAGAACAATCAGGAGGTTGATGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077968    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_052892.2-7467s1c1
Sequence:CCGGGTCATAGCTTTCATGTCCATTCTCGAGAATGGACATGAAAGCTATGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029686
PKD1L2 MISSION shRNA Bacterial Glycerol Stock
polycystic kidney disease 1-like 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000072154    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029686.1-6976s1c1
Sequence:CCGGGCGTATTCCTTTGCGTCAAATCTCGAGATTTGACGCAAAGGAATACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072156    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029686.1-3120s1c1
Sequence:CCGGGCTTCGGGTTATAGACCATTTCTCGAGAAATGGTCTATAACCCGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072157    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029686.1-1206s1c1
Sequence:CCGGGCAGCTTTACAATCTGACCTTCTCGAGAAGGTCAGATTGTAAAGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072155    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029686.1-1907s1c1
Sequence:CCGGCCCTGCATTTGGCTATCCTAACTCGAGTTAGGATAGCCAAATGCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072153    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029686.1-1652s1c1
Sequence:CCGGCGGGAATAAATGCTGAAGCAACTCGAGTTGCTTCAGCATTTATTCCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029686
PKD1L2 MISSION shRNA shRNA Plasmid DNA
polycystic kidney disease 1-like 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000072154    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029686.1-6976s1c1
Sequence:CCGGGCGTATTCCTTTGCGTCAAATCTCGAGATTTGACGCAAAGGAATACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072156    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029686.1-3120s1c1
Sequence:CCGGGCTTCGGGTTATAGACCATTTCTCGAGAAATGGTCTATAACCCGAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072157    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029686.1-1206s1c1
Sequence:CCGGGCAGCTTTACAATCTGACCTTCTCGAGAAGGTCAGATTGTAAAGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072155    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029686.1-1907s1c1
Sequence:CCGGCCCTGCATTTGGCTATCCTAACTCGAGTTAGGATAGCCAAATGCAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072153    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029686.1-1652s1c1
Sequence:CCGGCGGGAATAAATGCTGAAGCAACTCGAGTTGCTTCAGCATTTATTCCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029686
PKD1L2 MISSION shRNA Lentiviral Transduction Particles
polycystic kidney disease 1-like 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000072154    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029686.1-6976s1c1
Sequence:CCGGGCGTATTCCTTTGCGTCAAATCTCGAGATTTGACGCAAAGGAATACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072156    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029686.1-3120s1c1
Sequence:CCGGGCTTCGGGTTATAGACCATTTCTCGAGAAATGGTCTATAACCCGAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072157    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029686.1-1206s1c1
Sequence:CCGGGCAGCTTTACAATCTGACCTTCTCGAGAAGGTCAGATTGTAAAGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072155    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029686.1-1907s1c1
Sequence:CCGGCCCTGCATTTGGCTATCCTAACTCGAGTTAGGATAGCCAAATGCAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072153    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029686.1-1652s1c1
Sequence:CCGGCGGGAATAAATGCTGAAGCAACTCGAGTTGCTTCAGCATTTATTCCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)