EMAIL THIS PAGE TO A FRIEND

PKD2L2

polycystic kidney disease 2-like 2

71 Gene Product Result for
Synonyms: TRPP5
Gene ID:
Mouse(53871) polycystic kidney disease 2-like 2
Rat(291683) polycystic kidney disease 2-like 2
chicken(416298) polycystic kidney disease 2-like 2
dog(474689) polycystic kidney disease 2-like 2
domestic cat(101084929) polycystic kidney disease 2-like 2
cow(521683) polycystic kidney disease 2-like 2
sheep(101120575) polycystic kidney disease 2-like 2
domestic guinea pig(100725264) polycystic kidney disease 2-like 2
naked mole-rat(101709447) polycystic kidney disease 2-like 2
Domestic Rabbit(100342615) polycystic kidney disease 2-like 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014386 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014386 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014386 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_016927 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_016927 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_016927 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU060481 MISSION® esiRNA esiRNA human PKD2L2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014386 Rosetta Predictions human pricing
NM_001106156 Rosetta Predictions rat pricing
NM_016927 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014386 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00101205 predicted 1443
2 SASI_Hs02_00345554 predicted 1269
3 SASI_Hs01_00101206 predicted 1277
4 SASI_Hs02_00345555 predicted 232
5 SASI_Hs01_00101209 predicted 722
6 SASI_Hs01_00101211 predicted 510
7 SASI_Hs01_00101212 predicted 872
8 SASI_Hs02_00345556 predicted 491
9 SASI_Hs01_00101213 predicted 1390
10 SASI_Hs01_00101214 predicted 1221
11 SASI_Hs01_00101207 predicted 1285
12 SASI_Hs01_00101208 predicted 1567
13 SASI_Hs01_00101210 predicted 1516
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106156 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00216178 predicted 635
2 SASI_Rn02_00216179 predicted 194
3 SASI_Rn02_00216180 predicted 1165
4 SASI_Rn02_00216181 predicted 1661
5 SASI_Rn02_00216182 predicted 700
6 SASI_Rn02_00216183 predicted 1591
7 SASI_Rn02_00216184 predicted 1120
8 SASI_Rn02_00216185 predicted 1363
9 SASI_Rn02_00216186 predicted 1158
10 SASI_Rn02_00216187 predicted 612
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016927 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00143093 predicted 1537
2 SASI_Mm01_00143094 predicted 1526
3 SASI_Mm01_00143095 predicted 699
4 SASI_Mm01_00143096 predicted 1175
5 SASI_Mm01_00143097 predicted 1033
6 SASI_Mm01_00143098 predicted 633
7 SASI_Mm01_00143099 predicted 1144
8 SASI_Mm01_00143100 predicted 1784
9 SASI_Mm01_00143101 predicted 1361
10 SASI_Mm02_00323790 predicted 357
11 SASI_Mm01_00143092 predicted 1621
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014386
PKD2L2 MISSION shRNA Bacterial Glycerol Stock
polycystic kidney disease 2-like 2
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000415493    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014386.2-1445s21c1
Sequence:CCGGTCCTATCTTGGGACCCATTTACTCGAGTAAATGGGTCCCAAGATAGGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056290    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014386.1-323s1c1
Sequence:CCGGCTGGGATTCATGGTACAATAACTCGAGTTATTGTACCATGAATCCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424095    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014386.2-878s21c1
Sequence:CCGGTGTTAGCTACTATGACTATTTCTCGAGAAATAGTCATAGTAGCTAACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056291    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014386.1-1592s1c1
Sequence:CCGGCGAGAAATTCAGACTGAAGAACTCGAGTTCTTCAGTCTGAATTTCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056288    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014386.1-1469s1c1
Sequence:CCGGGCTGAATATGTTCTTGGCAATCTCGAGATTGCCAAGAACATATTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056289    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014386.1-1111s1c1
Sequence:CCGGGCTGGCACATTTATTACAATACTCGAGTATTGTAATAAATGTGCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056292    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014386.1-111s1c1
Sequence:CCGGCAGGAATTGTTACTCTACTTTCTCGAGAAAGTAGAGTAACAATTCCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427755    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014386.2-1905s21c1
Sequence:CCGGGCCAAGTACACACGATGATAGCTCGAGCTATCATCGTGTGTACTTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014386
PKD2L2 MISSION shRNA shRNA Plasmid DNA
polycystic kidney disease 2-like 2
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000415493    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014386.2-1445s21c1
Sequence:CCGGTCCTATCTTGGGACCCATTTACTCGAGTAAATGGGTCCCAAGATAGGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056290    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014386.1-323s1c1
Sequence:CCGGCTGGGATTCATGGTACAATAACTCGAGTTATTGTACCATGAATCCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424095    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014386.2-878s21c1
Sequence:CCGGTGTTAGCTACTATGACTATTTCTCGAGAAATAGTCATAGTAGCTAACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056291    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014386.1-1592s1c1
Sequence:CCGGCGAGAAATTCAGACTGAAGAACTCGAGTTCTTCAGTCTGAATTTCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056288    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014386.1-1469s1c1
Sequence:CCGGGCTGAATATGTTCTTGGCAATCTCGAGATTGCCAAGAACATATTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056289    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014386.1-1111s1c1
Sequence:CCGGGCTGGCACATTTATTACAATACTCGAGTATTGTAATAAATGTGCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056292    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014386.1-111s1c1
Sequence:CCGGCAGGAATTGTTACTCTACTTTCTCGAGAAAGTAGAGTAACAATTCCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427755    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014386.2-1905s21c1
Sequence:CCGGGCCAAGTACACACGATGATAGCTCGAGCTATCATCGTGTGTACTTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014386
PKD2L2 MISSION shRNA Lentiviral Transduction Particles
polycystic kidney disease 2-like 2
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000415493    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014386.2-1445s21c1
Sequence:CCGGTCCTATCTTGGGACCCATTTACTCGAGTAAATGGGTCCCAAGATAGGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056290    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014386.1-323s1c1
Sequence:CCGGCTGGGATTCATGGTACAATAACTCGAGTTATTGTACCATGAATCCCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424095    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014386.2-878s21c1
Sequence:CCGGTGTTAGCTACTATGACTATTTCTCGAGAAATAGTCATAGTAGCTAACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056291    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014386.1-1592s1c1
Sequence:CCGGCGAGAAATTCAGACTGAAGAACTCGAGTTCTTCAGTCTGAATTTCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056288    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014386.1-1469s1c1
Sequence:CCGGGCTGAATATGTTCTTGGCAATCTCGAGATTGCCAAGAACATATTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056289    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014386.1-1111s1c1
Sequence:CCGGGCTGGCACATTTATTACAATACTCGAGTATTGTAATAAATGTGCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056292    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014386.1-111s1c1
Sequence:CCGGCAGGAATTGTTACTCTACTTTCTCGAGAAAGTAGAGTAACAATTCCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427755    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014386.2-1905s21c1
Sequence:CCGGGCCAAGTACACACGATGATAGCTCGAGCTATCATCGTGTGTACTTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016927
PKD2L2 MISSION shRNA Bacterial Glycerol Stock
polycystic kidney disease 2-like 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000097786    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016927.1-959s1c1
Sequence:CCGGCGAGTTTAAGTCTGCCTATTTCTCGAGAAATAGGCAGACTTAAACTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097789    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016927.1-833s1c1
Sequence:CCGGCTGGCAGTTCTACTCTGTGAACTCGAGTTCACAGAGTAGAACTGCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097787    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016927.1-1124s1c1
Sequence:CCGGCCTTGCATACTGGCACATTTACTCGAGTAAATGTGCCAGTATGCAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097785    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016927.1-1949s1c1
Sequence:CCGGCCGAAGAATTTCATTCAGTATCTCGAGATACTGAATGAAATTCTTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097788    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016927.1-1613s1c1
Sequence:CCGGCGAGAAACTCAGACTCAAGAACTCGAGTTCTTGAGTCTGAGTTTCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016927
PKD2L2 MISSION shRNA shRNA Plasmid DNA
polycystic kidney disease 2-like 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000097786    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016927.1-959s1c1
Sequence:CCGGCGAGTTTAAGTCTGCCTATTTCTCGAGAAATAGGCAGACTTAAACTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097789    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016927.1-833s1c1
Sequence:CCGGCTGGCAGTTCTACTCTGTGAACTCGAGTTCACAGAGTAGAACTGCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097787    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016927.1-1124s1c1
Sequence:CCGGCCTTGCATACTGGCACATTTACTCGAGTAAATGTGCCAGTATGCAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097785    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016927.1-1949s1c1
Sequence:CCGGCCGAAGAATTTCATTCAGTATCTCGAGATACTGAATGAAATTCTTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097788    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016927.1-1613s1c1
Sequence:CCGGCGAGAAACTCAGACTCAAGAACTCGAGTTCTTGAGTCTGAGTTTCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016927
PKD2L2 MISSION shRNA Lentiviral Transduction Particles
polycystic kidney disease 2-like 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000097786    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016927.1-959s1c1
Sequence:CCGGCGAGTTTAAGTCTGCCTATTTCTCGAGAAATAGGCAGACTTAAACTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097789    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016927.1-833s1c1
Sequence:CCGGCTGGCAGTTCTACTCTGTGAACTCGAGTTCACAGAGTAGAACTGCCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097787    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016927.1-1124s1c1
Sequence:CCGGCCTTGCATACTGGCACATTTACTCGAGTAAATGTGCCAGTATGCAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097785    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016927.1-1949s1c1
Sequence:CCGGCCGAAGAATTTCATTCAGTATCTCGAGATACTGAATGAAATTCTTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097788    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016927.1-1613s1c1
Sequence:CCGGCGAGAAACTCAGACTCAAGAACTCGAGTTCTTGAGTCTGAGTTTCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)