EMAIL THIS PAGE TO A FRIEND

PKHD1L1

polycystic kidney and hepatic disease 1 (autosomal recessive)-like 1

99 Gene Product Result for
Synonyms: PKHDL1
UniProtKB ID: Q86WI1, Q567P2, Q9UF27
Gene ID:
Mouse(192190) polycystic kidney and hepatic disease 1-like 1
Rat(314917) polycystic kidney and hepatic disease 1-like 1
domestic guinea pig(100726622) polycystic kidney and hepatic disease 1 (autosomal recessive)-like 1
naked mole-rat(101714865) polycystic kidney and hepatic disease 1 (autosomal recessive)-like 1
cow(100336824) polycystic kidney and hepatic disease 1 (autosomal recessive)-like 1
sheep(101117676) polycystic kidney and hepatic disease 1 (autosomal recessive)-like 1
Zebrafish(569261) polycystic kidney and hepatic disease 1 (autosomal recessive)-like 1
Horse(100064208) polycystic kidney and hepatic disease 1 (autosomal recessive)-like 1
domestic cat(101091756) polycystic kidney and hepatic disease 1 (autosomal recessive)-like 1
dog(475075) polycystic kidney and hepatic disease 1 (autosomal recessive)-like 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_177531 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_177531 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_177531 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_138674 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_138674 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_138674 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_177531 Rosetta Predictions human pricing
NM_001034931 Rosetta Predictions rat pricing
NM_138674 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177531 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00369368 predicted 6032
2 SASI_Hs02_00369369 predicted 1594
3 SASI_Hs01_00150622 predicted 7194
4 SASI_Hs02_00369370 predicted 8662
5 SASI_Hs01_00150626 predicted 7406
6 SASI_Hs02_00369371 predicted 1315
7 SASI_Hs02_00369372 predicted 589
8 SASI_Hs02_00369373 predicted 11621
9 SASI_Hs01_00150628 predicted 7583
10 SASI_Hs01_00150629 predicted 11458
11 SASI_Hs01_00150623 predicted 10718
12 SASI_Hs01_00150624 predicted 10061
13 SASI_Hs01_00150625 predicted 11708
14 SASI_Hs01_00150627 predicted 11845
15 SASI_Hs01_00150630 predicted 11343
16 SASI_Hs01_00150631 predicted 6495
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001034931 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00204101 predicted 3631
2 SASI_Rn02_00204102 predicted 8412
3 SASI_Rn02_00204103 predicted 4621
4 SASI_Rn02_00204104 predicted 12396
5 SASI_Rn02_00204105 predicted 11182
6 SASI_Rn02_00204106 predicted 238
7 SASI_Rn02_00204107 predicted 11411
8 SASI_Rn02_00204108 predicted 10040
9 SASI_Rn02_00204109 predicted 4248
10 SASI_Rn02_00204110 predicted 2703
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138674 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00339746 predicted 8305
2 SASI_Mm02_00339747 predicted 2373
3 SASI_Mm01_00074659 predicted 12004
4 SASI_Mm01_00074660 predicted 8703
5 SASI_Mm02_00339748 predicted 10942
6 SASI_Mm01_00074662 predicted 3577
7 SASI_Mm01_00074663 predicted 6574
8 SASI_Mm01_00074664 predicted 8376
9 SASI_Mm01_00074665 predicted 5348
10 SASI_Mm01_00074666 predicted 2359
11 SASI_Mm01_00074661 predicted 10248
12 SASI_Mm01_00074667 predicted 2651
13 SASI_Mm01_00074668 predicted 7481
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177531
PKHD1L1 MISSION shRNA Bacterial Glycerol Stock
polycystic kidney and hepatic disease 1 (autosomal recessive)-like 1
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000434651    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177531.4-4874s21c1
Sequence:CCGCTAATCTCCCATGGGCTAATAACTCGAGTTATTAGCCCATGGGAGATTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433808    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177531.4-2493s21c1
Sequence:CCGGGATCTCGTAAGAACGAAATACCTCGAGGTATTTCGTTCTTACGAGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425953    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177531.4-215s21c1
Sequence:CCGGACCTAAATATGGCAGTATAAACTCGAGTTTATACTGCCATATTTAGGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148100    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177531.2-11473s1c1
Sequence:CCGGGCAACGGTTATGTTGATCTTACTCGAGTAAGATCAACATAACCGTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148813    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177531.2-10251s1c1
Sequence:CCGGCGAGGGAATTTGATTGCACTTCTCGAGAAGTGCAATCAAATTCCCTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149123    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177531.2-10432s1c1
Sequence:CCGGGCCAGTTTAATCCTGTGGAAACTCGAGTTTCCACAGGATTAAACTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149882    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177531.2-6166s1c1
Sequence:CCGGGCACCGGATTTAATCCACAAACTCGAGTTTGTGGATTAAATCCGGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424123    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177531.4-1820s21c1
Sequence:CCGGGAATGACCTCTGGTCTATAAACTCGAGTTTATAGACCAGAGGTCATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130197    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177531.2-1842s1c1
Sequence:CCGGCCGGACACAGTTCAAGTAATACTCGAGTATTACTTGAACTGTGTCCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128474    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177531.2-2422s1c1
Sequence:CCGGGCACTGATACACAGTTTACATCTCGAGATGTAAACTGTGTATCAGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148646    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177531.2-5227s1c1
Sequence:CCGGCGGCCATTGAATGTGAAACATCTCGAGATGTTTCACATTCAATGGCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129977    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177531.2-2714s1c1
Sequence:CCGGGCCAACTATGACAAACCAATACTCGAGTATTGGTTTGTCATAGTTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177531
PKHD1L1 MISSION shRNA shRNA Plasmid DNA
polycystic kidney and hepatic disease 1 (autosomal recessive)-like 1
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000434651    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177531.4-4874s21c1
Sequence:CCGCTAATCTCCCATGGGCTAATAACTCGAGTTATTAGCCCATGGGAGATTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000433808    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177531.4-2493s21c1
Sequence:CCGGGATCTCGTAAGAACGAAATACCTCGAGGTATTTCGTTCTTACGAGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425953    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177531.4-215s21c1
Sequence:CCGGACCTAAATATGGCAGTATAAACTCGAGTTTATACTGCCATATTTAGGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148100    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177531.2-11473s1c1
Sequence:CCGGGCAACGGTTATGTTGATCTTACTCGAGTAAGATCAACATAACCGTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148813    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177531.2-10251s1c1
Sequence:CCGGCGAGGGAATTTGATTGCACTTCTCGAGAAGTGCAATCAAATTCCCTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000149123    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177531.2-10432s1c1
Sequence:CCGGGCCAGTTTAATCCTGTGGAAACTCGAGTTTCCACAGGATTAAACTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000149882    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177531.2-6166s1c1
Sequence:CCGGGCACCGGATTTAATCCACAAACTCGAGTTTGTGGATTAAATCCGGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424123    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177531.4-1820s21c1
Sequence:CCGGGAATGACCTCTGGTCTATAAACTCGAGTTTATAGACCAGAGGTCATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130197    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177531.2-1842s1c1
Sequence:CCGGCCGGACACAGTTCAAGTAATACTCGAGTATTACTTGAACTGTGTCCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128474    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177531.2-2422s1c1
Sequence:CCGGGCACTGATACACAGTTTACATCTCGAGATGTAAACTGTGTATCAGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148646    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177531.2-5227s1c1
Sequence:CCGGCGGCCATTGAATGTGAAACATCTCGAGATGTTTCACATTCAATGGCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129977    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177531.2-2714s1c1
Sequence:CCGGGCCAACTATGACAAACCAATACTCGAGTATTGGTTTGTCATAGTTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177531
PKHD1L1 MISSION shRNA Lentiviral Transduction Particles
polycystic kidney and hepatic disease 1 (autosomal recessive)-like 1
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000434651    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177531.4-4874s21c1
Sequence:CCGCTAATCTCCCATGGGCTAATAACTCGAGTTATTAGCCCATGGGAGATTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433808    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177531.4-2493s21c1
Sequence:CCGGGATCTCGTAAGAACGAAATACCTCGAGGTATTTCGTTCTTACGAGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425953    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177531.4-215s21c1
Sequence:CCGGACCTAAATATGGCAGTATAAACTCGAGTTTATACTGCCATATTTAGGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148100    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177531.2-11473s1c1
Sequence:CCGGGCAACGGTTATGTTGATCTTACTCGAGTAAGATCAACATAACCGTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148813    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177531.2-10251s1c1
Sequence:CCGGCGAGGGAATTTGATTGCACTTCTCGAGAAGTGCAATCAAATTCCCTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149123    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177531.2-10432s1c1
Sequence:CCGGGCCAGTTTAATCCTGTGGAAACTCGAGTTTCCACAGGATTAAACTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149882    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177531.2-6166s1c1
Sequence:CCGGGCACCGGATTTAATCCACAAACTCGAGTTTGTGGATTAAATCCGGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424123    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177531.4-1820s21c1
Sequence:CCGGGAATGACCTCTGGTCTATAAACTCGAGTTTATAGACCAGAGGTCATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130197    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177531.2-1842s1c1
Sequence:CCGGCCGGACACAGTTCAAGTAATACTCGAGTATTACTTGAACTGTGTCCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128474    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177531.2-2422s1c1
Sequence:CCGGGCACTGATACACAGTTTACATCTCGAGATGTAAACTGTGTATCAGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148646    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177531.2-5227s1c1
Sequence:CCGGCGGCCATTGAATGTGAAACATCTCGAGATGTTTCACATTCAATGGCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129977    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177531.2-2714s1c1
Sequence:CCGGGCCAACTATGACAAACCAATACTCGAGTATTGGTTTGTCATAGTTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138674
PKHD1L1 MISSION shRNA Bacterial Glycerol Stock
polycystic kidney and hepatic disease 1 (autosomal recessive)-like 1
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000192518    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138674.2-12370s1c1
Sequence:CCGGGCTATCCTAAAGGACTCCAATCTCGAGATTGGAGTCCTTTAGGATAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192833    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138674.2-11681s1c1
Sequence:CCGGGCACAGAACAATTCCTTCCTACTCGAGTAGGAAGGAATTGTTCTGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201059    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138674.2-5262s1c1
Sequence:CCGGCCCAAACTCAATCCAAGGATACTCGAGTATCCTTGGATTGAGTTTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201348    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138674.2-1129s1c1
Sequence:CCGGGCTTCCTATGTTTGGCCTATACTCGAGTATAGGCCAAACATAGGAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138674
PKHD1L1 MISSION shRNA shRNA Plasmid DNA
polycystic kidney and hepatic disease 1 (autosomal recessive)-like 1
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000192518    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138674.2-12370s1c1
Sequence:CCGGGCTATCCTAAAGGACTCCAATCTCGAGATTGGAGTCCTTTAGGATAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000192833    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138674.2-11681s1c1
Sequence:CCGGGCACAGAACAATTCCTTCCTACTCGAGTAGGAAGGAATTGTTCTGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000201059    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138674.2-5262s1c1
Sequence:CCGGCCCAAACTCAATCCAAGGATACTCGAGTATCCTTGGATTGAGTTTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000201348    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138674.2-1129s1c1
Sequence:CCGGGCTTCCTATGTTTGGCCTATACTCGAGTATAGGCCAAACATAGGAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138674
PKHD1L1 MISSION shRNA Lentiviral Transduction Particles
polycystic kidney and hepatic disease 1 (autosomal recessive)-like 1
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000192518    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138674.2-12370s1c1
Sequence:CCGGGCTATCCTAAAGGACTCCAATCTCGAGATTGGAGTCCTTTAGGATAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192833    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138674.2-11681s1c1
Sequence:CCGGGCACAGAACAATTCCTTCCTACTCGAGTAGGAAGGAATTGTTCTGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201059    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138674.2-5262s1c1
Sequence:CCGGCCCAAACTCAATCCAAGGATACTCGAGTATCCTTGGATTGAGTTTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201348    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138674.2-1129s1c1
Sequence:CCGGGCTTCCTATGTTTGGCCTATACTCGAGTATAGGCCAAACATAGGAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)