EMAIL THIS PAGE TO A FRIEND

PKIB

protein kinase (cAMP-dependent, catalytic) inhibitor beta

181 Gene Product Result for
Synonyms: PRKACN2
UniProtKB ID: Q9C010, B2RCK2, Q567T9, Q5T0Z7
Gene ID:
Human(5570) Summary: This gene encodes a member of the cAMP-dependent protein kinase inhibitor family. The encoded protein may play a role in the protein kinase A (PKA) pathway by interacting with the catalytic subunit of PKA, and overexpression of this gene may play a role in prostate cancer. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jul 2012]
Mouse(18768) protein kinase inhibitor beta, cAMP dependent, testis specific
Rat(24678) protein kinase (cAMP-dependent, catalytic) inhibitor beta
domestic guinea pig(100720393) protein kinase (cAMP-dependent, catalytic) inhibitor beta
naked mole-rat(101722377) protein kinase (cAMP-dependent, catalytic) inhibitor beta
cow(615798) protein kinase (cAMP-dependent, catalytic) inhibitor beta
sheep(101121016) protein kinase (cAMP-dependent, catalytic) inhibitor beta
Goat(100860939) protein kinase (cAMP-dependent, catalytic) inhibitor beta
Zebrafish(797348) protein kinase (cAMP-dependent, catalytic) inhibitor beta
chicken(769402) protein kinase (cAMP-dependent, catalytic) inhibitor beta
dog(100683903) protein kinase (cAMP-dependent, catalytic) inhibitor beta
domestic cat(101082658) protein kinase (cAMP-dependent, catalytic) inhibitor beta
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032471 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032471 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032471 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008863 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008863 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008863 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU085881 MISSION® esiRNA esiRNA human PKIB (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032471 Rosetta Predictions human pricing
NM_181794 Rosetta Predictions human pricing
NM_181795 Rosetta Predictions human pricing
NM_001076553 Rosetta Predictions rat pricing
NM_012627 Rosetta Predictions rat pricing
NM_001039050 Rosetta Predictions mouse pricing
NM_001039051 Rosetta Predictions mouse pricing
NM_001039052 Rosetta Predictions mouse pricing
NM_001039053 Rosetta Predictions mouse pricing
NM_008863 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032471 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00026037 predicted 878
2 SASI_Hs01_00026038 predicted 778
3 SASI_Hs01_00026039 predicted 991
4 SASI_Hs01_00026040 predicted 740
5 SASI_Hs01_00026041 predicted 712
6 SASI_Hs01_00026042 predicted 633
7 SASI_Hs01_00026043 predicted 764
8 SASI_Hs01_00026044 predicted 766
9 SASI_Hs01_00026045 predicted 797
10 SASI_Hs01_00026046 predicted 889
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181794 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00058219 predicted 935
2 SASI_Hs01_00058220 predicted 837
3 SASI_Hs01_00058221 predicted 1053
4 SASI_Hs01_00058222 predicted 810
5 SASI_Hs01_00058223 predicted 774
6 SASI_Hs01_00058224 predicted 698
7 SASI_Hs01_00058225 predicted 829
8 SASI_Hs01_00058226 predicted 832
9 SASI_Hs01_00058227 predicted 859
10 SASI_Hs01_00058228 predicted 957
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181795 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00216077 predicted 939
2 SASI_Hs01_00216078 predicted 840
3 SASI_Hs01_00216079 predicted 1060
4 SASI_Hs01_00216080 predicted 809
5 SASI_Hs01_00216081 predicted 774
6 SASI_Hs01_00216082 predicted 696
7 SASI_Hs01_00216083 predicted 838
8 SASI_Hs01_00216084 predicted 842
9 SASI_Hs01_00216085 predicted 867
10 SASI_Hs01_00216086 predicted 956
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001076553 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00207462 predicted 970
2 SASI_Rn02_00207463 predicted 969
3 SASI_Rn02_00207464 predicted 952
4 SASI_Rn02_00207465 predicted 960
5 SASI_Rn02_00207466 predicted 1012
6 SASI_Rn02_00207467 predicted 961
7 SASI_Rn02_00207468 predicted 949
8 SASI_Rn02_00207469 predicted 965
9 SASI_Rn02_00207470 predicted 964
10 SASI_Rn02_00207471 predicted 970
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012627 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00259841 predicted 872
2 SASI_Rn02_00259842 predicted 859
3 SASI_Rn02_00259843 predicted 856
4 SASI_Rn02_00259844 predicted 860
5 SASI_Rn02_00259845 predicted 912
6 SASI_Rn01_00116608 predicted 853
7 SASI_Rn02_00259846 predicted 849
8 SASI_Rn02_00259847 predicted 861
9 SASI_Rn02_00259848 predicted 861
10 SASI_Rn02_00259849 predicted 872
11 SASI_Rn01_00116604 predicted 814
12 SASI_Rn01_00116605 predicted 834
13 SASI_Rn01_00116606 predicted 261
14 SASI_Rn01_00116607 predicted 830
15 SASI_Rn01_00116609 predicted 761
16 SASI_Rn01_00116610 predicted 727
17 SASI_Rn01_00116611 predicted 779
18 SASI_Rn01_00116612 predicted 744
19 SASI_Rn01_00116613 predicted 466
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039050 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00078445 predicted 1236
2 SASI_Mm01_00078447 predicted 1154
3 SASI_Mm01_00078448 predicted 1182
4 SASI_Mm01_00078449 predicted 1160
5 SASI_Mm01_00078450 predicted 1146
6 SASI_Mm01_00078453 predicted 599
7 SASI_Mm01_00078454 predicted 1154
8 SASI_Mm02_00289735 predicted 1052
9 SASI_Mm02_00289736 predicted 1168
10 SASI_Mm02_00289737 predicted 723
11 SASI_Mm01_00078446 predicted 1223
12 SASI_Mm01_00078451 predicted 1220
13 SASI_Mm01_00078452 predicted 1221
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039051 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00120170 predicted 931
2 SASI_Mm01_00120172 predicted 846
3 SASI_Mm01_00120173 predicted 873
4 SASI_Mm01_00120174 predicted 849
5 SASI_Mm01_00120175 predicted 840
6 SASI_Mm01_00120178 predicted 297
7 SASI_Mm01_00120179 predicted 850
8 SASI_Mm02_00289738 predicted 743
9 SASI_Mm02_00289739 predicted 863
10 SASI_Mm02_00289740 predicted 416
11 SASI_Mm01_00120171 predicted 917
12 SASI_Mm01_00120176 predicted 917
13 SASI_Mm01_00120177 predicted 910
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039052 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00160035 predicted 900
2 SASI_Mm01_00160037 predicted 817
3 SASI_Mm01_00160038 predicted 845
4 SASI_Mm01_00160039 predicted 827
5 SASI_Mm01_00160040 predicted 813
6 SASI_Mm01_00160043 predicted 263
7 SASI_Mm01_00160044 predicted 824
8 SASI_Mm02_00289741 predicted 718
9 SASI_Mm02_00289742 predicted 830
10 SASI_Mm02_00289743 predicted 389
11 SASI_Mm01_00160036 predicted 889
12 SASI_Mm01_00160041 predicted 891
13 SASI_Mm01_00160042 predicted 890
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039053 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00195847 predicted 383
2 SASI_Mm01_00195848 predicted 836
3 SASI_Mm01_00195850 predicted 893
4 SASI_Mm01_00195851 predicted 531
5 SASI_Mm01_00195852 predicted 395
6 SASI_Mm01_00195853 predicted 384
7 SASI_Mm02_00289744 predicted 712
8 SASI_Mm01_00195854 predicted 760
9 SASI_Mm01_00195855 predicted 594
10 SASI_Mm01_00195856 predicted 676
11 SASI_Mm01_00195849 predicted 793
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008863 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00115060 predicted 1050
2 SASI_Mm01_00115062 predicted 965
3 SASI_Mm01_00115063 predicted 992
4 SASI_Mm01_00115064 predicted 973
5 SASI_Mm01_00115065 predicted 955
6 SASI_Mm01_00115068 predicted 414
7 SASI_Mm01_00115069 predicted 969
8 SASI_Mm02_00314820 predicted 867
9 SASI_Mm02_00314821 predicted 979
10 SASI_Mm02_00314822 predicted 534
11 SASI_Mm01_00115061 predicted 1042
12 SASI_Mm01_00115066 predicted 1032
13 SASI_Mm01_00115067 predicted 1041
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032471
VALIDATED
PKIB MISSION shRNA Bacterial Glycerol Stock
protein kinase (cAMP-dependent, catalytic) inhibitor beta
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000380391    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032471.4-983s21c1
Sequence:GTACCGGGGCAAATCATTCTTGGTAAATCTCGAGATTTACCAAGAATGATTTGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273287    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032471.4-489s21c1
Sequence:CCGGCCAGACATCCAGAGTTCAGCTCTCGAGAGCTGAACTCTGGATGTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273351    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032471.4-806s21c1
Sequence:CCGGATGTCCAAGGTAAGCTATTAACTCGAGTTAATAGCTTACCTTGGACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002815    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_032471.x-512s1c1
Sequence:CCGGCACAGACGGAACCTCAGATTTCTCGAGAAATCTGAGGTTCCGTCTGTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002816    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_032471.x-489s1c1
Sequence:CCGGCCAGACATCCAGAGTTCAGCTCTCGAGAGCTGAACTCTGGATGTCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002818    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032471.x-1327s1c1
Sequence:CCGGCCCTAACTTTGGTCTGTGTATCTCGAGATACACAGACCAAAGTTAGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002819    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_032471.x-511s1c1
Sequence:CCGGCCACAGACGGAACCTCAGATTCTCGAGAATCTGAGGTTCCGTCTGTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002817    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_032471.x-484s1c1
Sequence:CCGGCCTTACCAGACATCCAGAGTTCTCGAGAACTCTGGATGTCTGGTAAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273353    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032471.4-633s21c1
Sequence:CCGGTGAAGGCTCATAATCTATCAACTCGAGTTGATAGATTATGAGCCTTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273290    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032471.4-511s21c1
Sequence:CCGGCCACAGACGGAACCTCAGATTCTCGAGAATCTGAGGTTCCGTCTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381106    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032471.4-717s21c1
Sequence:GTACCGGGTGGTAACTGTGGTAACATTGCTCGAGCAATGTTACCACAGTTACCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273289    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032471.4-553s21c1
Sequence:CCGGTCTCCGTGAAGGAAGATGCAACTCGAGTTGCATCTTCCTTCACGGAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032471
VALIDATED
PKIB MISSION shRNA shRNA Plasmid DNA
protein kinase (cAMP-dependent, catalytic) inhibitor beta
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000380391    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032471.4-983s21c1
Sequence:GTACCGGGGCAAATCATTCTTGGTAAATCTCGAGATTTACCAAGAATGATTTGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000273287    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032471.4-489s21c1
Sequence:CCGGCCAGACATCCAGAGTTCAGCTCTCGAGAGCTGAACTCTGGATGTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000273351    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032471.4-806s21c1
Sequence:CCGGATGTCCAAGGTAAGCTATTAACTCGAGTTAATAGCTTACCTTGGACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002815    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_032471.x-512s1c1
Sequence:CCGGCACAGACGGAACCTCAGATTTCTCGAGAAATCTGAGGTTCCGTCTGTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002816    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_032471.x-489s1c1
Sequence:CCGGCCAGACATCCAGAGTTCAGCTCTCGAGAGCTGAACTCTGGATGTCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002818    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032471.x-1327s1c1
Sequence:CCGGCCCTAACTTTGGTCTGTGTATCTCGAGATACACAGACCAAAGTTAGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002819    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_032471.x-511s1c1
Sequence:CCGGCCACAGACGGAACCTCAGATTCTCGAGAATCTGAGGTTCCGTCTGTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002817    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_032471.x-484s1c1
Sequence:CCGGCCTTACCAGACATCCAGAGTTCTCGAGAACTCTGGATGTCTGGTAAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000273353    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032471.4-633s21c1
Sequence:CCGGTGAAGGCTCATAATCTATCAACTCGAGTTGATAGATTATGAGCCTTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000273290    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032471.4-511s21c1
Sequence:CCGGCCACAGACGGAACCTCAGATTCTCGAGAATCTGAGGTTCCGTCTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000381106    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032471.4-717s21c1
Sequence:GTACCGGGTGGTAACTGTGGTAACATTGCTCGAGCAATGTTACCACAGTTACCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000273289    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032471.4-553s21c1
Sequence:CCGGTCTCCGTGAAGGAAGATGCAACTCGAGTTGCATCTTCCTTCACGGAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032471
VALIDATED
PKIB MISSION shRNA Lentiviral Transduction Particles
protein kinase (cAMP-dependent, catalytic) inhibitor beta
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000380391    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032471.4-983s21c1
Sequence:GTACCGGGGCAAATCATTCTTGGTAAATCTCGAGATTTACCAAGAATGATTTGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273287    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032471.4-489s21c1
Sequence:CCGGCCAGACATCCAGAGTTCAGCTCTCGAGAGCTGAACTCTGGATGTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273351    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032471.4-806s21c1
Sequence:CCGGATGTCCAAGGTAAGCTATTAACTCGAGTTAATAGCTTACCTTGGACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002815    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_032471.x-512s1c1
Sequence:CCGGCACAGACGGAACCTCAGATTTCTCGAGAAATCTGAGGTTCCGTCTGTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002816    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_032471.x-489s1c1
Sequence:CCGGCCAGACATCCAGAGTTCAGCTCTCGAGAGCTGAACTCTGGATGTCTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002818    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032471.x-1327s1c1
Sequence:CCGGCCCTAACTTTGGTCTGTGTATCTCGAGATACACAGACCAAAGTTAGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002819    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_032471.x-511s1c1
Sequence:CCGGCCACAGACGGAACCTCAGATTCTCGAGAATCTGAGGTTCCGTCTGTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002817    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_032471.x-484s1c1
Sequence:CCGGCCTTACCAGACATCCAGAGTTCTCGAGAACTCTGGATGTCTGGTAAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273353    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032471.4-633s21c1
Sequence:CCGGTGAAGGCTCATAATCTATCAACTCGAGTTGATAGATTATGAGCCTTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273290    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032471.4-511s21c1
Sequence:CCGGCCACAGACGGAACCTCAGATTCTCGAGAATCTGAGGTTCCGTCTGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381106    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032471.4-717s21c1
Sequence:GTACCGGGTGGTAACTGTGGTAACATTGCTCGAGCAATGTTACCACAGTTACCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273289    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032471.4-553s21c1
Sequence:CCGGTCTCCGTGAAGGAAGATGCAACTCGAGTTGCATCTTCCTTCACGGAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008863
PKIB MISSION shRNA Bacterial Glycerol Stock
protein kinase (cAMP-dependent, catalytic) inhibitor beta
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000362645    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008863.3-1023s21c1
Sequence:CCGGTGGTATGTATAGACCGAAATCCTCGAGGATTTCGGTCTATACATACCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362576    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008863.3-504s21c1
Sequence:CCGGAGAGTTCACTGGCTACAAGTGCTCGAGCACTTGTAGCCAGTGAACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362578    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008863.3-528s21c1
Sequence:CCGGCCTCTGATCTTCCACTGAAACCTCGAGGTTTCAGTGGAAGATCAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362577    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008863.3-868s21c1
Sequence:CCGGATGATACGGAAATAGGTTATTCTCGAGAATAACCTATTTCCGTATCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088742    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008863.2-591s1c1
Sequence:CCGGGAAGAGAAAGACCAAGGCCAACTCGAGTTGGCCTTGGTCTTTCTCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088738    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008863.2-2182s1c1
Sequence:CCGGGCTGGGTATAAAGGGAGGATACTCGAGTATCCTCCCTTTATACCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088739    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008863.2-407s1c1
Sequence:CCGGGAGGACAGATTCATCAGAGATCTCGAGATCTCTGATGAATCTGTCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088741    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008863.2-502s1c1
Sequence:CCGGTCCAGAGTTCACTGGCTACAACTCGAGTTGTAGCCAGTGAACTCTGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088740    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008863.2-528s1c1
Sequence:CCGGTCCTCTGATCTTCCACTGAAACTCGAGTTTCAGTGGAAGATCAGAGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008863
PKIB MISSION shRNA shRNA Plasmid DNA
protein kinase (cAMP-dependent, catalytic) inhibitor beta
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000362645    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008863.3-1023s21c1
Sequence:CCGGTGGTATGTATAGACCGAAATCCTCGAGGATTTCGGTCTATACATACCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000362576    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008863.3-504s21c1
Sequence:CCGGAGAGTTCACTGGCTACAAGTGCTCGAGCACTTGTAGCCAGTGAACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000362578    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008863.3-528s21c1
Sequence:CCGGCCTCTGATCTTCCACTGAAACCTCGAGGTTTCAGTGGAAGATCAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000362577    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008863.3-868s21c1
Sequence:CCGGATGATACGGAAATAGGTTATTCTCGAGAATAACCTATTTCCGTATCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088742    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008863.2-591s1c1
Sequence:CCGGGAAGAGAAAGACCAAGGCCAACTCGAGTTGGCCTTGGTCTTTCTCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088738    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008863.2-2182s1c1
Sequence:CCGGGCTGGGTATAAAGGGAGGATACTCGAGTATCCTCCCTTTATACCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088739    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008863.2-407s1c1
Sequence:CCGGGAGGACAGATTCATCAGAGATCTCGAGATCTCTGATGAATCTGTCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088741    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008863.2-502s1c1
Sequence:CCGGTCCAGAGTTCACTGGCTACAACTCGAGTTGTAGCCAGTGAACTCTGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088740    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008863.2-528s1c1
Sequence:CCGGTCCTCTGATCTTCCACTGAAACTCGAGTTTCAGTGGAAGATCAGAGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008863
PKIB MISSION shRNA Lentiviral Transduction Particles
protein kinase (cAMP-dependent, catalytic) inhibitor beta
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000362645    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008863.3-1023s21c1
Sequence:CCGGTGGTATGTATAGACCGAAATCCTCGAGGATTTCGGTCTATACATACCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362576    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008863.3-504s21c1
Sequence:CCGGAGAGTTCACTGGCTACAAGTGCTCGAGCACTTGTAGCCAGTGAACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362578    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008863.3-528s21c1
Sequence:CCGGCCTCTGATCTTCCACTGAAACCTCGAGGTTTCAGTGGAAGATCAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362577    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008863.3-868s21c1
Sequence:CCGGATGATACGGAAATAGGTTATTCTCGAGAATAACCTATTTCCGTATCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088742    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008863.2-591s1c1
Sequence:CCGGGAAGAGAAAGACCAAGGCCAACTCGAGTTGGCCTTGGTCTTTCTCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088738    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008863.2-2182s1c1
Sequence:CCGGGCTGGGTATAAAGGGAGGATACTCGAGTATCCTCCCTTTATACCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088739    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008863.2-407s1c1
Sequence:CCGGGAGGACAGATTCATCAGAGATCTCGAGATCTCTGATGAATCTGTCCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088741    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008863.2-502s1c1
Sequence:CCGGTCCAGAGTTCACTGGCTACAACTCGAGTTGTAGCCAGTGAACTCTGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088740    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008863.2-528s1c1
Sequence:CCGGTCCTCTGATCTTCCACTGAAACTCGAGTTTCAGTGGAAGATCAGAGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)