EMAIL THIS PAGE TO A FRIEND

PKIG

protein kinase (cAMP-dependent, catalytic) inhibitor gamma

119 Gene Product Result for
Synonyms: PKI-gamma
UniProtKB ID: Q9Y2B9
Gene ID:
Human(11142) Summary: The protein encoded by this gene is a member of the cAMP-dependent protein kinase (PKA) inhibitor family. Studies of a similar protein in mice suggest that this protein acts as a potent competitive PKA inhibitor, and is a predominant form of PKA inhibitors in various tissues. Three alternatively spliced transcript variants encoding the same protein have been reported. [provided by RefSeq, Jul 2008]
Mouse(18769) protein kinase inhibitor, gamma
Rat(266709) protein kinase inhibitor, gamma
Zebrafish(503808) protein kinase (cAMP-dependent, catalytic) inhibitor gamma
domestic cat(101092173) protein kinase (cAMP-dependent, catalytic) inhibitor gamma
dog(610925) protein kinase (cAMP-dependent, catalytic) inhibitor gamma
chicken(419195) protein kinase (cAMP-dependent, catalytic) inhibitor gamma
cow(404169) protein kinase (cAMP-dependent, catalytic) inhibitor gamma
sheep(101109727) protein kinase (cAMP-dependent, catalytic) inhibitor gamma
naked mole-rat(101708360) protein kinase (cAMP-dependent, catalytic) inhibitor gamma
domestic guinea pig(100714293) protein kinase (cAMP-dependent, catalytic) inhibitor gamma
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011106 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011106 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011106 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_181805 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_181805 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_181805 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU083011 MISSION® esiRNA esiRNA targeting mouse Pkig (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_007066 Rosetta Predictions human pricing
NM_181804 Rosetta Predictions human pricing
NM_181805 Rosetta Predictions human pricing
NM_153469 Rosetta Predictions rat pricing
NM_001039390 Rosetta Predictions mouse pricing
NM_001039391 Rosetta Predictions mouse pricing
NM_011106 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007066 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00088909 predicted 482
2 SASI_Hs01_00088910 predicted 519
3 SASI_Hs01_00088911 predicted 498
4 SASI_Hs01_00088913 predicted 591
5 SASI_Hs01_00088914 predicted 482
6 SASI_Hs01_00088915 predicted 480
7 SASI_Hs01_00088916 predicted 444
8 SASI_Hs01_00088917 predicted 608
9 SASI_Hs01_00088918 predicted 497
10 SASI_Hs02_00342883 predicted 483
11 SASI_Hs01_00088912 predicted 494
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181804 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00089259 predicted 637
2 SASI_Hs01_00089260 predicted 662
3 SASI_Hs01_00089261 predicted 642
4 SASI_Hs01_00089263 predicted 739
5 SASI_Hs01_00089264 predicted 638
6 SASI_Hs01_00089265 predicted 626
7 SASI_Hs01_00089266 predicted 591
8 SASI_Hs01_00089267 predicted 755
9 SASI_Hs01_00089268 predicted 647
10 SASI_Hs02_00370405 predicted 638
11 SASI_Hs01_00089262 predicted 644
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181805 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00222566 predicted 741
2 SASI_Hs01_00222567 predicted 765
3 SASI_Hs01_00222568 predicted 745
4 SASI_Hs01_00222570 predicted 844
5 SASI_Hs01_00222571 predicted 627
6 SASI_Hs01_00222572 predicted 735
7 SASI_Hs01_00222573 predicted 728
8 SASI_Hs01_00222574 predicted 697
9 SASI_Hs01_00222575 predicted 854
10 SASI_Hs02_00370406 predicted 751
11 SASI_Hs01_00222569 predicted 746
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153469 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00268980 predicted 359
2 SASI_Rn02_00268981 predicted 215
3 SASI_Rn01_00096663 predicted 261
4 SASI_Rn01_00096664 predicted 409
5 SASI_Rn01_00096665 predicted 271
6 SASI_Rn01_00096666 predicted 431
7 SASI_Rn01_00096669 predicted 270
8 SASI_Rn01_00096670 predicted 276
9 SASI_Rn01_00096671 predicted 293
10 SASI_Rn01_00096672 predicted 275
11 SASI_Rn01_00096667 predicted 365
12 SASI_Rn01_00096668 predicted 355
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039390 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00290032 predicted 423
2 SASI_Mm02_00290033 predicted 345
3 SASI_Mm02_00290034 predicted 517
4 SASI_Mm02_00290035 predicted 520
5 SASI_Mm02_00290036 predicted 419
6 SASI_Mm02_00290037 predicted 517
7 SASI_Mm02_00290038 predicted 446
8 SASI_Mm02_00290039 predicted 500
9 SASI_Mm02_00290040 predicted 425
10 SASI_Mm02_00290041 predicted 328
11 SASI_Mm01_00186972 predicted 354
12 SASI_Mm01_00186973 predicted 641
13 SASI_Mm01_00186974 predicted 904
14 SASI_Mm01_00186975 predicted 934
15 SASI_Mm01_00186976 predicted 921
16 SASI_Mm01_00186977 predicted 915
17 SASI_Mm01_00186978 predicted 947
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039391 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00290042 predicted 335
2 SASI_Mm01_00056385 predicted 519
3 SASI_Mm02_00290043 predicted 261
4 SASI_Mm02_00290044 predicted 424
5 SASI_Mm02_00290045 predicted 429
6 SASI_Mm02_00290046 predicted 334
7 SASI_Mm02_00290047 predicted 369
8 SASI_Mm02_00290048 predicted 365
9 SASI_Mm02_00290049 predicted 413
10 SASI_Mm02_00290050 predicted 345
11 SASI_Mm01_00056386 predicted 528
12 SASI_Mm01_00056387 predicted 533
13 SASI_Mm01_00056388 predicted 486
14 SASI_Mm01_00056389 predicted 266
15 SASI_Mm01_00056390 predicted 554
16 SASI_Mm01_00056391 predicted 824
17 SASI_Mm01_00056392 predicted 846
18 SASI_Mm01_00056393 predicted 839
19 SASI_Mm01_00056394 predicted 834
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011106 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00319911 predicted 410
2 SASI_Mm02_00319912 predicted 340
3 SASI_Mm02_00319913 predicted 500
4 SASI_Mm02_00319914 predicted 512
5 SASI_Mm02_00319915 predicted 407
6 SASI_Mm02_00319916 predicted 445
7 SASI_Mm02_00319917 predicted 509
8 SASI_Mm02_00319918 predicted 436
9 SASI_Mm02_00319919 predicted 497
10 SASI_Mm02_00319920 predicted 414
11 SASI_Mm01_00033836 predicted 344
12 SASI_Mm01_00033837 predicted 636
13 SASI_Mm01_00033838 predicted 895
14 SASI_Mm01_00033839 predicted 924
15 SASI_Mm01_00033840 predicted 916
16 SASI_Mm01_00033841 predicted 908
17 SASI_Mm01_00033842 predicted 930
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011106
VALIDATED
PKIG MISSION shRNA Bacterial Glycerol Stock
protein kinase (cAMP-dependent, catalytic) inhibitor gamma
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000088603    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_011106.1-638s1c1
Sequence:CCGGGCACCATGAGATGTTATTTATCTCGAGATAAATAACATCTCATGGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088605    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011106.1-423s1c1
Sequence:CCGGGCAGTGATGCGAACACCTCATCTCGAGATGAGGTGTTCGCATCACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088606    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011106.1-415s1c1
Sequence:CCGGGCCTGAGAGCAGTGATGCGAACTCGAGTTCGCATCACTGCTCTCAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088607    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_011106.1-410s1c1
Sequence:CCGGAGCCAGCCTGAGAGCAGTGATCTCGAGATCACTGCTCTCAGGCTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088604    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_011106.1-350s1c1
Sequence:CCGGCTCGCACTTGAGGGAGCAGAACTCGAGTTCTGCTCCCTCAAGTGCGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000349436    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011106.2-346s21c1
Sequence:CCGGCTCGCACTTGAGGGAGCAGAACTCGAGTTCTGCTCCCTCAAGTGCGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313290    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011106.2-888s21c1
Sequence:CCGGAGCCGTTTAAAGCTCAGTTCTCTCGAGAGAACTGAGCTTTAAACGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312328    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011106.2-419s21c1
Sequence:CCGGGCAGTGATGCGAACACCTCATCTCGAGATGAGGTGTTCGCATCACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312327    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011106.2-406s21c1
Sequence:CCGGAGCCAGCCTGAGAGCAGTGATCTCGAGATCACTGCTCTCAGGCTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313289    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011106.2-627s21c1
Sequence:CCGGGACACCAGCACCATGAGATGTCTCGAGACATCTCATGGTGCTGGTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011106
VALIDATED
PKIG MISSION shRNA shRNA Plasmid DNA
protein kinase (cAMP-dependent, catalytic) inhibitor gamma
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000088603    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_011106.1-638s1c1
Sequence:CCGGGCACCATGAGATGTTATTTATCTCGAGATAAATAACATCTCATGGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088605    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011106.1-423s1c1
Sequence:CCGGGCAGTGATGCGAACACCTCATCTCGAGATGAGGTGTTCGCATCACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088606    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011106.1-415s1c1
Sequence:CCGGGCCTGAGAGCAGTGATGCGAACTCGAGTTCGCATCACTGCTCTCAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088607    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_011106.1-410s1c1
Sequence:CCGGAGCCAGCCTGAGAGCAGTGATCTCGAGATCACTGCTCTCAGGCTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088604    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_011106.1-350s1c1
Sequence:CCGGCTCGCACTTGAGGGAGCAGAACTCGAGTTCTGCTCCCTCAAGTGCGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000349436    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011106.2-346s21c1
Sequence:CCGGCTCGCACTTGAGGGAGCAGAACTCGAGTTCTGCTCCCTCAAGTGCGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000313290    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011106.2-888s21c1
Sequence:CCGGAGCCGTTTAAAGCTCAGTTCTCTCGAGAGAACTGAGCTTTAAACGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000312328    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011106.2-419s21c1
Sequence:CCGGGCAGTGATGCGAACACCTCATCTCGAGATGAGGTGTTCGCATCACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000312327    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011106.2-406s21c1
Sequence:CCGGAGCCAGCCTGAGAGCAGTGATCTCGAGATCACTGCTCTCAGGCTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000313289    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011106.2-627s21c1
Sequence:CCGGGACACCAGCACCATGAGATGTCTCGAGACATCTCATGGTGCTGGTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011106
VALIDATED
PKIG MISSION shRNA Lentiviral Transduction Particles
protein kinase (cAMP-dependent, catalytic) inhibitor gamma
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000088603    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_011106.1-638s1c1
Sequence:CCGGGCACCATGAGATGTTATTTATCTCGAGATAAATAACATCTCATGGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088605    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011106.1-423s1c1
Sequence:CCGGGCAGTGATGCGAACACCTCATCTCGAGATGAGGTGTTCGCATCACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088606    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011106.1-415s1c1
Sequence:CCGGGCCTGAGAGCAGTGATGCGAACTCGAGTTCGCATCACTGCTCTCAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088607    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_011106.1-410s1c1
Sequence:CCGGAGCCAGCCTGAGAGCAGTGATCTCGAGATCACTGCTCTCAGGCTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088604    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_011106.1-350s1c1
Sequence:CCGGCTCGCACTTGAGGGAGCAGAACTCGAGTTCTGCTCCCTCAAGTGCGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000349436    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011106.2-346s21c1
Sequence:CCGGCTCGCACTTGAGGGAGCAGAACTCGAGTTCTGCTCCCTCAAGTGCGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313290    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011106.2-888s21c1
Sequence:CCGGAGCCGTTTAAAGCTCAGTTCTCTCGAGAGAACTGAGCTTTAAACGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312328    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011106.2-419s21c1
Sequence:CCGGGCAGTGATGCGAACACCTCATCTCGAGATGAGGTGTTCGCATCACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312327    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011106.2-406s21c1
Sequence:CCGGAGCCAGCCTGAGAGCAGTGATCTCGAGATCACTGCTCTCAGGCTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313289    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011106.2-627s21c1
Sequence:CCGGGACACCAGCACCATGAGATGTCTCGAGACATCTCATGGTGCTGGTGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_181805
VALIDATED
PKIG MISSION shRNA Bacterial Glycerol Stock
protein kinase (cAMP-dependent, catalytic) inhibitor gamma
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000037965    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_181805.1-599s1c1
Sequence:CCGGCCTGACATCCAGGGAGACTCACTCGAGTGAGTCTCCCTGGATGTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037966    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_181805.1-738s1c1
Sequence:CCGGGCGATGGGACCACCTCGTCTTCTCGAGAAGACGAGGTGGTCCCATCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037964    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_181805.1-703s1c1
Sequence:CCGGCCCAGACAAGGAAGCTGGCAACTCGAGTTGCCAGCTTCCTTGTCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037968    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181805.1-558s1c1
Sequence:CCGGACTTCATCTCCTGTGACCGGACTCGAGTCCGGTCACAGGAGATGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037967    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_181805.1-631s1c1
Sequence:CCGGCGTGAGGAAGCTGGCTGGAGACTCGAGTCTCCAGCCAGCTTCCTCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298923    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_181805.1-738s21c1
Sequence:CCGGGCGATGGGACCACCTCGTCTTCTCGAGAAGACGAGGTGGTCCCATCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296002    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_181805.1-759s21c1
Sequence:CCGGGAATCTGACCTTGTCCAAGAACTCGAGTTCTTGGACAAGGTCAGATTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296003    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_181805.1-999s21c1
Sequence:CCGGTGTAACCACAAGATGTTATTTCTCGAGAAATAACATCTTGTGGTTACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298852    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181805.1-599s21c1
Sequence:CCGGCCTGACATCCAGGGAGACTCACTCGAGTGAGTCTCCCTGGATGTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000310346    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_181805.1-631s21c1
Sequence:CCGGCGTGAGGAAGCTGGCTGGAGACTCGAGTCTCCAGCCAGCTTCCTCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_181805
VALIDATED
PKIG MISSION shRNA shRNA Plasmid DNA
protein kinase (cAMP-dependent, catalytic) inhibitor gamma
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000037965    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_181805.1-599s1c1
Sequence:CCGGCCTGACATCCAGGGAGACTCACTCGAGTGAGTCTCCCTGGATGTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037966    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_181805.1-738s1c1
Sequence:CCGGGCGATGGGACCACCTCGTCTTCTCGAGAAGACGAGGTGGTCCCATCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037964    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_181805.1-703s1c1
Sequence:CCGGCCCAGACAAGGAAGCTGGCAACTCGAGTTGCCAGCTTCCTTGTCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037968    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181805.1-558s1c1
Sequence:CCGGACTTCATCTCCTGTGACCGGACTCGAGTCCGGTCACAGGAGATGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037967    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_181805.1-631s1c1
Sequence:CCGGCGTGAGGAAGCTGGCTGGAGACTCGAGTCTCCAGCCAGCTTCCTCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000298923    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_181805.1-738s21c1
Sequence:CCGGGCGATGGGACCACCTCGTCTTCTCGAGAAGACGAGGTGGTCCCATCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000296002    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_181805.1-759s21c1
Sequence:CCGGGAATCTGACCTTGTCCAAGAACTCGAGTTCTTGGACAAGGTCAGATTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000296003    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_181805.1-999s21c1
Sequence:CCGGTGTAACCACAAGATGTTATTTCTCGAGAAATAACATCTTGTGGTTACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000298852    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181805.1-599s21c1
Sequence:CCGGCCTGACATCCAGGGAGACTCACTCGAGTGAGTCTCCCTGGATGTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000310346    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_181805.1-631s21c1
Sequence:CCGGCGTGAGGAAGCTGGCTGGAGACTCGAGTCTCCAGCCAGCTTCCTCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_181805
VALIDATED
PKIG MISSION shRNA Lentiviral Transduction Particles
protein kinase (cAMP-dependent, catalytic) inhibitor gamma
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000037965    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_181805.1-599s1c1
Sequence:CCGGCCTGACATCCAGGGAGACTCACTCGAGTGAGTCTCCCTGGATGTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037966    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_181805.1-738s1c1
Sequence:CCGGGCGATGGGACCACCTCGTCTTCTCGAGAAGACGAGGTGGTCCCATCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037964    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_181805.1-703s1c1
Sequence:CCGGCCCAGACAAGGAAGCTGGCAACTCGAGTTGCCAGCTTCCTTGTCTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037968    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181805.1-558s1c1
Sequence:CCGGACTTCATCTCCTGTGACCGGACTCGAGTCCGGTCACAGGAGATGAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037967    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_181805.1-631s1c1
Sequence:CCGGCGTGAGGAAGCTGGCTGGAGACTCGAGTCTCCAGCCAGCTTCCTCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298923    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_181805.1-738s21c1
Sequence:CCGGGCGATGGGACCACCTCGTCTTCTCGAGAAGACGAGGTGGTCCCATCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296002    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_181805.1-759s21c1
Sequence:CCGGGAATCTGACCTTGTCCAAGAACTCGAGTTCTTGGACAAGGTCAGATTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296003    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_181805.1-999s21c1
Sequence:CCGGTGTAACCACAAGATGTTATTTCTCGAGAAATAACATCTTGTGGTTACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298852    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181805.1-599s21c1
Sequence:CCGGCCTGACATCCAGGGAGACTCACTCGAGTGAGTCTCCCTGGATGTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000310346    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_181805.1-631s21c1
Sequence:CCGGCGTGAGGAAGCTGGCTGGAGACTCGAGTCTCCAGCCAGCTTCCTCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)